Compare commits

...
179 Commits
Author SHA1 Message Date
Eric Coissac eea884f393 ci: improve release workflow and bump obikmer to v1.1.37
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m5s
Release / build-macos-arm64 (push) Successful in 1m41s
Replace inline `docker run` with explicit container lifecycle management to improve isolation and verify exit statuses. Bump `obikmer` crate version to 1.1.37. Add debug logging for sparse hit structure memory tracking, update chunk memory documentation to reflect the Findere rework, and clarify `BYTES_PER_KMER_PER_GENOME` as a pathological bound for safety tuning.
2026-07-07 19:11:50 +02:00
Eric Coissac ae42a061bd perf: optimize k-mer queries with sparse index and run-based aggregation
Replaces the dense `KmerResults` matrix with a sparse `SmerIndex` (`Vec<bool>` + offsets) that tracks k-mer presence independently of per-genome counts. Introduces a new aggregation pass, `sparse_findere_for_genome`, which sorts hits, detects contiguous runs, and applies monotone-deque scans to compute sliding-window minimums. This reduces query complexity from O(n_smers) to O(hits log hits), significantly lowering memory overhead and computational cost for low-density queries. Adds a deterministic PRNG and dense reference oracle in tests to validate correctness against randomized inputs without external property-testing crates.
2026-07-07 18:56:41 +02:00
Eric Coissac 040eff140c refactor(query): optimize mmap locality with column-major matrix fetch
Refactor the query pipeline into a two-stage MPHF hit-detection pass followed by a column-major matrix fetch to improve cache efficiency. Introduce a QueryHit enum for event-driven callbacks, decoupling hit detection from data population. Add scan/fetch metrics to QueryStats, update Phase 4 architecture docs, and align tests with the new callback signature.
2026-07-07 18:44:09 +02:00
Eric Coissac a348637f3b refactor(query): deduplicate k-mers upfront and split MPHF lookup
Refactor `QueryBatch` construction to perform canonical k-mer deduplication and partition routing during initialization, eliminating post-batch splitting. Split the `QueryLayer` MPHF lookup into separate `find_slot` and `fill_row` methods, updating callbacks to pass occurrence descriptors instead of indices. Introduce `QueryStats` for tracking MPHF calls and dereplication ratios, and add comprehensive unit tests for batch construction, stats arithmetic, and safe partition handling. Expose new query-layer types in the public API.
2026-07-07 18:36:25 +02:00
Eric Coissac 9d7ced4493 perf(query): replace static divisor with dynamic overhead multiplier
Replaces the static 16 divisor with a dynamic overhead_multiplier that scales chunk size based on n_genomes, the --detail flag, and a safety factor. This bounds per-chunk memory usage to ≤50% of available RAM across concurrent workers by accounting for genome-scaled k-mer buffers and optional coverage data.
2026-07-07 16:14:10 +02:00
Eric Coissac 9d49929b0c refactor(query): implement throttled per-file streaming pipeline
Replace the flat chunk iterator with a throttled, per-file streaming architecture using `obipipeline::throttle`. The new `GuardedChunkIter` binds file handles to their `ThrottleGuard`, enforcing concurrent open-file limits and tracking active files via an atomic counter. Pipeline stages and the progress spinner are updated to support this resource-aware, parallelized I/O flow.
2026-07-07 16:07:33 +02:00
Eric Coissac 61c390503d feat(query): add throughput metering and --max-open-files flag
Introduces an EMA-based throughput meter that dynamically updates a spinner with MB/s rates, along with atomic counters for tracking cumulative bytes and active chunks. Adds final pipeline reporting and consolidates imports for cleaner performance instrumentation.
2026-07-07 15:19:09 +02:00
Eric Coissac 8f0ceec784 docs: clarify query processing and add performance roadmap
Clarifies that query processing is fully inlined within `process_chunk` using flat allocations, refining monotone-deque sliding window semantics and `kmer_missing` tracking. Updates `QueryLayer::open` variant precedence and introduces a phased roadmap (Phases 0–6) to address performance bottlenecks through parallel I/O, genome-aware chunk sizing, k-mer dereplication, NUMA-aware matrix fetches, and sparse Findere rework.
2026-07-07 15:12:09 +02:00
Eric Coissac 00b4b1fa51 docs: add future work section for parallel gzip decompression
Proposes replacing the single-threaded niffler/flate2 pipeline in `obiread::xopen` with `rapidgzip-rs` for local `.gz` files. Details constraints such as path dependencies, non-seekable streams, C++ toolchain requirements, and binding maturity. Marks the optimization as parked pending throughput and correctness validation.
2026-07-07 13:43:01 +02:00
coissac e96ad38c8e Merge pull request 'feat: filter zero-valued entries from kmer strict matches output' (#58) from push-rosnxrytzxzk into main
Reviewed-on: #58
2026-07-07 09:22:02 +00:00
Eric Coissac 4fc7860825 feat: filter zero-valued entries from kmer strict matches output
Release / create-release (push) Successful in 2m32s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m23s
Optimize query serialization by conditionally excluding genomes with zero total matches. This reduces JSON payload size while preserving the label-to-count mapping structure. Updates architecture documentation and bumps version to 1.1.36.
2026-07-07 10:50:01 +02:00
coissac 5bdc0f826a Merge pull request 'fix: validate packed matrix columns before repacking' (#57) from push-vkqvorvsqnqx into main
Reviewed-on: #57
2026-07-03 15:26:55 +00:00
Eric Coissac cd2f2f9417 fix: validate packed matrix columns before repacking
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m15s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m17s
Add header parsing helpers to extract column counts without memory mapping. Update packing functions to verify existing files match current metadata, preventing stale or widened-column artifacts. Extract inline tests in obilayeredmap to an external module and add comprehensive aggregation tests. Bump obikmer to 1.1.35 and clean up repository configuration.
2026-07-03 17:20:22 +02:00
coissac 7844239a8e Merge pull request 'Push msotyzponsls' (#56) from push-msotyzponsls into main
Reviewed-on: #56
2026-07-03 11:28:49 +00:00
Eric Coissac 2b37e8aac4 fix(bitmatrix): explicitly compute diagonal entries for self-similarity
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m21s
The pairwise matrix functions now explicitly calculate and overwrite diagonal entries using `f(i,i)`, replacing previous implicit symmetric mirroring or default values. Documentation has been updated to clarify that diagonals represent self-comparison weights, ensuring accurate self-similarity calculations. Additionally, the obikmer crate version has been bumped to 1.1.34.
2026-07-03 13:04:40 +02:00
Eric Coissac 67b4e4da53 refactor(numa): replace flat runner with per-node activation channels
Shifts the NUMA-aware runner from a flat, round-robin model to a per-node architecture using dedicated `NodeActivation` channels. Replaces absolute deltas with relative scaling based on the previous growth step's worker count, decoupling growth from node count to fix slow ramp-up and enforce per-node fairness. Updates architecture documentation to reflect these changes and focus tuning questions on `INITIAL`/`GROWTH_DIVISOR` parameters for I/O-bound validation.
2026-07-03 13:03:31 +02:00
coissac 66ab4c6db1 Merge pull request 'feat(numa): introduce I/O sampling to prevent activation stalls' (#55) from push-ooruxnkktvvz into main
Reviewed-on: #55
2026-07-02 09:36:19 +00:00
Eric Coissac f84dd539bf feat(numa): introduce I/O sampling to prevent activation stalls
Release / create-release (push) Successful in 2m25s
Release / build-linux-x86_64 (push) Successful in 8m47s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m30s
Replaces the monolithic CPU scaling threshold with separate CPU and I/O spawn thresholds. Introduces an `IoSample` struct with platform-specific byte reading and a relative throughput growth heuristic. Adds a 0.1s wall-clock guard to `CpuSample` to suppress artificial efficiency spikes, and updates `maybe_activate` to trigger worker scaling when either resource indicates headroom. Bumps `obikmer` to v1.1.33 and updates architecture documentation.
2026-07-02 10:07:22 +02:00
coissac 6378734e1c Merge pull request 'fix(obisys): remove activation guard to always update metrics' (#54) from push-vkloynurrxzu into main
Reviewed-on: #54
2026-07-01 18:34:10 +00:00
Eric Coissac b3a617cce1 fix(obisys): remove activation guard to always update metrics
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m35s
Release / build-linux-x86_64 (push) Successful in 8m9s
Release / build-macos-arm64 (push) Failing after 30s
Removes the `if activate` conditional in `src/obisys/src/lib.rs`, making debug logging and state updates for performance counters execute unconditionally. This ensures tracking metrics are continuously refreshed regardless of the activation threshold. Also bumps the `obikmer` dependency version.
2026-07-01 20:32:56 +02:00
coissac 2080e5e8a9 Merge pull request 'ci: fix registry auth and bump obikmer to 1.1.30' (#53) from push-zxlknspoxknt into main
Reviewed-on: #53
2026-07-01 14:20:09 +00:00
Eric Coissac 45ed2bc9b8 ci: fix registry auth and bump obikmer to 1.1.30
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m12s
Release / build-macos-arm64 (push) Failing after 1m55s
CI / build (pull_request) Successful in 3m32s
Update the release workflow to explicitly resolve the Docker registry username from repository secrets instead of inferring it from the runner's actor. Bump the obikmer package version to 1.1.30.
2026-07-01 14:31:30 +02:00
coissac aa126fd89d Merge pull request 'feat: simplify worker spawning logic and update macOS build workflow' (#52) from push-uvmlknmzqqnx into main
Reviewed-on: #52
2026-07-01 09:50:51 +00:00
Eric Coissac c612132763 feat: simplify worker spawning logic and update macOS build workflow
Release / create-release (push) Successful in 2m59s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 8s
CI / build (pull_request) Successful in 3m24s
Updates the release workflow to run macOS builds inside a Docker container with explicit registry authentication and adjusted artifact paths. Bumps the obikmer crate version to 1.1.29 and adds *.log to .gitignore. Simplifies NUMA worker spawning by lowering the activation threshold from 0.95 to 0.2, replacing complex stateful tracking with a direct efficiency check, and downgrading progress logging to debug level. Includes general code formatting improvements for readability.
2026-07-01 11:40:57 +02:00
coissac 19660f8cd0 Merge pull request 'ci: update registry auth and improve adaptive worker scaling' (#51) from push-qlpywtroutvx into main
Reviewed-on: #51
2026-06-26 13:16:23 +00:00
Eric Coissac 7b07540a69 ci: update registry auth and improve adaptive worker scaling
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m17s
Release / build-linux-x86_64 (push) Successful in 8m3s
Release / build-macos-arm64 (push) Failing after 1s
Refactor the release workflow to use a structured container object with authenticated pulls for macOS ARM64 builds. Replace single-worker activation with dynamic upfront provisioning based on node and worker counts. Implement an absolute efficiency gain threshold for scaling checks and add early termination to improve adaptive scaling stability. Bump obikmer crate version to 1.1.27.
2026-06-26 15:13:13 +02:00
coissac 89c43e28f5 Merge pull request 'ci: update release workflow and bump obikmer to 1.1.26' (#50) from push-npttlqpomtvz into main
Reviewed-on: #50
2026-06-24 13:55:40 +00:00
Eric Coissac b9b2e42ad2 ci: update release workflow and bump obikmer to 1.1.26
Release / create-release (push) Successful in 2m32s
CI / build (pull_request) Successful in 3m47s
Release / build-linux-x86_64 (push) Successful in 8m18s
Release / build-macos-arm64 (push) Failing after 0s
Replaces the macOS ARM64 cross-compilation container with a custom internal registry image. Adds explicit steps to install the `aarch64-apple-darwin` Rust target and `jq`, and updates the build command to use `--no-default-features`. Bumps the `obikmer` package version from 1.1.25 to 1.1.26.
2026-06-24 15:55:02 +02:00
coissac ca42fdff2f Merge pull request 'ci: update macOS ARM64 build workflow and bump obikmer version' (#49) from push-lllnsqlrqrut into main
Reviewed-on: #49
2026-06-23 13:15:20 +00:00
Eric Coissac 136cd89efb ci: update macOS ARM64 build workflow and bump obikmer version
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 7m52s
Release / build-macos-arm64 (push) Failing after 8m53s
CI / build (pull_request) Successful in 5m31s
Replace manual Zig/cargo-zigbuild setup with a pre-configured Docker container (`joseluisq/rust-linux-darwin-builder`). Use explicit Clang cross-compilers for native macOS ARM64 compilation. Bump the `obikmer` package version to 1.1.25.
2026-06-23 15:01:17 +02:00
coissac a4bbf607b7 Merge pull request 'Push kxsopnzprltv' (#48) from push-kxsopnzprltv into main
Reviewed-on: #48
2026-06-23 09:51:33 +00:00
Eric Coissac 9927100a1c chore: update obikmer to 1.1.24
Release / create-release (push) Successful in 2m24s
Release / build-linux-x86_64 (push) Successful in 7m49s
Release / build-macos-arm64 (push) Failing after 3m31s
CI / build (pull_request) Successful in 3m22s
Bumps the obikmer version in Cargo.toml from 1.1.21 to 1.1.24 and updates Cargo.lock to align with the upstream patch release (1.1.23). This ensures consistent dependency resolution across builds.
2026-06-23 11:47:54 +02:00
Eric Coissac 527258f822 ci: enforce macOS 11.0 deployment target for ARM builds
Adds MACOSX_DEPLOYMENT_TARGET=11.0 environment variable and updates the cargo zigbuild target to aarch64-apple-darwin11.0 to explicitly require macOS 11.0 for ARM binary compilation.
2026-06-23 11:46:09 +02:00
coissac ef62f1947e Merge pull request 'chore: bump version to 1.1.21 and update obikindex features' (#47) from push-xwutoxpnxorz into main
Reviewed-on: #47
2026-06-23 08:31:31 +00:00
Eric Coissac d02316dcf6 chore: bump version to 1.1.21 and update obikindex features
Release / create-release (push) Successful in 2m29s
CI / build (pull_request) Successful in 4m36s
Release / build-linux-x86_64 (push) Successful in 10m25s
Release / build-macos-arm64 (push) Failing after 4m50s
Disables default features for the `obikindex` dependency and introduces a `[features]` block. The new `numa` feature is set as the default, conditionally enabling NUMA support in `obikindex`.
2026-06-23 10:30:39 +02:00
coissac c323b3eaef Merge pull request 'Bump obikmer to 1.1.20 and update release workflow' (#46) from push-wpnywwlwxrps into main
Reviewed-on: #46
2026-06-23 08:03:58 +00:00
Eric Coissac b77d8e9ca0 Bump obikmer to 1.1.20 and update release workflow
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m14s
Release / build-linux-x86_64 (push) Successful in 7m44s
Release / build-macos-arm64 (push) Failing after 7m13s
Update the Gitea release workflow to fetch a full git clone with complete history, ensuring all commits and tags are available for accurate version resolution. This prepares the repository for the standard patch-level release of obikmer v1.1.20.
2026-06-23 10:03:15 +02:00
coissac 7c5bab3694 Merge pull request 'fix(ci): restrict workflow to PRs and improve release tagging' (#45) from push-louqrszyuqpz into main
Reviewed-on: #45
2026-06-23 07:52:35 +00:00
Eric Coissac fab4e0d6de fix(ci): restrict workflow to PRs and improve release tagging
Release / create-release (push) Failing after 26s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m17s
Restrict the CI pipeline to pull request events only by removing the unconfigured push trigger and eliminating a duplicate pull_request block in the workflow file. Update the Makefile to suppress stderr from the aichat command and introduce a fallback release tag message for robust version tagging. Additionally, bump the obikmer crate version to 1.1.19.
2026-06-23 09:42:23 +02:00
coissac 973a3f3d6e Merge pull request 'feat: add numa feature flag and automate release workflow' (#44) from push-uymxyvsyooro into main
CI / build (push) Successful in 3m16s
Reviewed-on: #44
2026-06-23 07:22:33 +00:00
Eric Coissac 1a839a295a feat: add numa feature flag and automate release workflow
Release / create-release (push) Failing after 37s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m23s
Refactor the Gitea release pipeline to generate releases via API and upload binaries using a shared ID. Automate changelog generation by fetching recent commits with `jj log` and producing markdown notes via `aichat`. Convert `hwlocality` to an optional dependency gated by a default `numa` feature, providing fallback implementations for graceful degradation when NUMA support is disabled. Bump obikmer to 1.1.18.
2026-06-23 09:07:04 +02:00
coissac 2ea58703c7 Merge pull request 'Push zkptpswyxnvt' (#43) from push-zkptpswyxnvt into main
CI / build (push) Successful in 3m19s
Reviewed-on: #43
2026-06-22 16:29:59 +00:00
Eric Coissac ac3ef106e7 refactor: implement adaptive worker scaling and infallible NUMA build
Release / build-linux-static (push) Successful in 8m4s
CI / build (pull_request) Successful in 3m26s
Replaces the fallible NUMA topology builder with an infallible fallback that synthesizes a single-node UMA configuration on failure or absence. Refactors PartitionRunner to pre-spawn dormant workers and dynamically activate them via CPU efficiency thresholds, replacing static upfront spawning with adaptive scaling. Bumps obikmer crate version to 1.1.15.
2026-06-22 18:29:39 +02:00
Eric Coissac 469e53b6f5 Add genomic distance benchmarking suite and test data
Introduces scripts to compute and validate pairwise genomic distance matrices across multiple metrics. Updates the Makefile with build and comparison targets, adds .gitignore rules for generated outputs, and includes test CSV matrices and a Newick phylogenetic tree for validating the distance computation pipeline.
2026-06-22 18:24:30 +02:00
Eric Coissac 9f1df96ea7 ci: restrict push trigger to main branch
Replace the wildcard `['**']` in the push trigger with `['main']`. This prevents redundant pipeline runs on non-main branches during push events.
2026-06-22 16:58:44 +02:00
coissac 4e4cce2879 Merge pull request 'fix(ci): enable cross-compilation in release workflow and bump obikmer' (#42) from push-sxlpkrkyuttk into main
CI / build (push) Successful in 3m20s
Reviewed-on: #42
2026-06-22 14:31:26 +00:00
Eric Coissac 68b05b93c4 fix(ci): enable cross-compilation in release workflow and bump obikmer
CI / build (push) Successful in 4m38s
Release / build-linux-static (push) Successful in 10m14s
CI / build (pull_request) Successful in 3m40s
Injects PKG_CONFIG_ALLOW_CROSS=1 into the static binary build step to ensure correct native dependency resolution during musl target compilation with cargo zigbuild. Also updates the obikmer crate version from 1.1.13 to 1.1.14.
2026-06-22 16:31:04 +02:00
coissac 0a668cf8a6 Merge pull request 'chore: bump obikmer to 1.1.13 and fix Makefile revision tag' (#41) from push-qwzpxktnlyls into main
CI / build (push) Has been cancelled
Reviewed-on: #41
2026-06-22 14:18:25 +00:00
Eric Coissac e6d6942e2f chore: bump obikmer to 1.1.13 and fix Makefile revision tag
CI / build (push) Has been cancelled
Release / build-linux-static (push) Has been cancelled
CI / build (pull_request) Has been cancelled
Update the obikmer crate version from 1.1.12 to 1.1.13 in Cargo.toml. Additionally, change the Makefile's Git revision specifier from @- to @ to ensure the version tag is applied to the current commit before pushing.
2026-06-22 16:17:52 +02:00
coissac bf9c9aeacb Merge pull request 'chore: bump version to 1.1.12 and fix release workflow' (#40) from push-zmkxouxypspm into main
CI / build (push) Has been cancelled
Reviewed-on: #40
2026-06-22 14:13:13 +00:00
Eric Coissac 22a65857a1 chore: bump version to 1.1.12 and fix release workflow
CI / build (push) Successful in 3m14s
CI / build (pull_request) Successful in 3m51s
Update Cargo.toml to 1.1.12 for a semver patch release. Refactor the Makefile release target to explicitly retrieve the parent commit hash via `jj log` and apply the tag, replacing implicit working directory tagging. Remove `jj auto-describe` and `--change @` in favor of an explicit `git push origin` for the version tag.
2026-06-22 16:12:56 +02:00
coissac d16a867640 Merge pull request 'ci: bypass PEP 668 restrictions and update obikmer to 1.1.11' (#39) from push-mxysluysloxr into main
CI / build (push) Successful in 4m1s
Release / build-linux-static (push) Failing after 7m28s
Reviewed-on: #39
2026-06-22 13:52:51 +00:00
Eric Coissac 616050075f ci: bypass PEP 668 restrictions and update obikmer to 1.1.11
CI / build (push) Successful in 3m41s
CI / build (pull_request) Successful in 3m49s
Add the `--break-system-packages` flag to the `pip install ziglang` command in the Gitea release workflow to bypass PEP 668 restrictions on modern Linux distributions. Additionally, bump the `obikmer` crate version from 1.1.9 to 1.1.11 across both Cargo.toml and Cargo.lock.
2026-06-22 15:52:34 +02:00
coissac e22afe9621 Merge pull request 'chore: bump obikmer to 1.1.9 and update release workflow' (#38) from push-noxuppsknsol into main
CI / build (push) Successful in 3m11s
Release / build-linux-static (push) Failing after 3m4s
Reviewed-on: #38
2026-06-22 13:32:50 +00:00
Eric Coissac bdfac71e65 chore: bump obikmer to 1.1.9 and update release workflow
CI / build (push) Successful in 3m24s
CI / build (pull_request) Failing after 0s
Bumps the obikmer crate version from 1.1.7 to 1.1.9 in Cargo.toml and Cargo.lock. Updates the Gitea release workflow to dynamically locate the Zig compiler via Python, generating musl-targeted gcc/g++ wrapper scripts installed to /usr/local/bin for static Linux cross-compilation during releases.
2026-06-22 15:32:10 +02:00
coissac a00bb37478 Merge pull request 'ci: switch to Zig build toolchain and bump obikmer to 1.1.7' (#37) from push-nvvqmzmrotxx into main
CI / build (push) Successful in 3m14s
Release / build-linux-static (push) Failing after 2m42s
Reviewed-on: #37
2026-06-22 13:20:12 +00:00
Eric Coissac d30a4efd9b ci: switch to Zig build toolchain and bump obikmer to 1.1.7
CI / build (push) Successful in 3m12s
CI / build (pull_request) Successful in 3m16s
Replaces the musl-based static Linux build toolchain with Zig (`ziglang` via pip and `cargo-zigbuild`), removing `musl-tools` dependencies. The workflow now invokes `cargo zigbuild` for cross-compiling the static binary. Additionally, bumps the `obikmer` crate version to 1.1.7.
2026-06-22 15:19:39 +02:00
coissac 6baf2e64ca Merge pull request 'chore: bump obikmer to 1.1.6 and automate git tagging' (#36) from push-yxmtknzsynpx into main
CI / build (push) Successful in 3m20s
Release / build-linux-static (push) Failing after 4m30s
Reviewed-on: #36
2026-06-22 13:01:06 +00:00
Eric Coissac c0a71a2d49 chore: bump obikmer to 1.1.6 and automate git tagging
CI / build (push) Successful in 4m46s
CI / build (pull_request) Successful in 4m27s
Bumps the obikmer crate version from 0.1.4 to 1.1.6 in Cargo.toml and Cargo.lock. Updates the Makefile release target to automatically extract the version, create a Git tag, and push it to the remote repository, extending the existing workflow with standard Git publishing steps.
2026-06-22 15:00:36 +02:00
coissac a609c1af95 Merge pull request 'ci: streamline release workflow and bump obikmer to 0.1.4' (#35) from push-zokprynyqunu into main
CI / build (push) Successful in 4m41s
Release / build-linux-static (push) Failing after 6m4s
Reviewed-on: #35
2026-06-22 09:38:36 +00:00
Eric Coissac 3d32be8a83 ci: streamline release workflow and bump obikmer to 0.1.4
CI / build (push) Successful in 4m33s
CI / build (pull_request) Successful in 4m17s
Replaces the intermediate artifact upload step in the Gitea release workflow with a direct REST API call, eliminating unnecessary dependencies and adding `jq`. Also increments the obikmer crate version to 0.1.4.
2026-06-22 11:38:19 +02:00
coissac c4c71dc892 Merge pull request 'Push mtzqmmrlmzzx' (#34) from push-mtzqmmrlmzzx into main
CI / build (push) Successful in 4m34s
Reviewed-on: #34
2026-06-22 08:47:24 +00:00
Eric Coissac 4e625afaba refactor: update CI toolchain setup and optimize parallel indexing
CI / build (push) Successful in 4m56s
CI / build (pull_request) Successful in 4m11s
Update CI workflows to explicitly install the Rust toolchain via rustup and configure musl targets for deterministic static builds in Docker containers. Bump obikmer dependency to 0.1.3. Refactor obicompactvec to reduce peak memory usage by computing column sizes from filesystem metadata, add atomic writes, and implement cleanup guards. Replace parallel iteration patterns in obikindex with a structured PartitionRunner pipeline for simplified error handling and progress tracking.
2026-06-22 10:46:24 +02:00
Eric Coissac a522c0907e feat: add CI/CD workflows, release automation, and CLI version flag
CI / build (push) Failing after 2m41s
CI / build (pull_request) Failing after 6s
Adds Gitea Actions for continuous integration and tagged releases, including static musl binary compilation and artifact upload. Introduces a Makefile target to automate semantic version bumping and publishing. Bumps the package version to 0.1.1 and enables automatic `--version` output via Clap.
2026-06-22 10:36:40 +02:00
Eric Coissac c1d6f277ce feat(select): add metrics reporting to selection methods
Integrates an obisys::Reporter across indexing and command modules to capture execution metrics. Replaces discarded timer stops with explicit rep.push() calls, adds timing instrumentation for the pack stage, and prints collected reports after each selection branch.
2026-06-22 10:25:24 +02:00
Eric Coissac 9356be4ec0 feat: introduce obitaxonomy crate for hierarchical taxonomy parsing
Adds the `obitaxonomy` crate to parse and validate hierarchical taxonomy paths using a strict `taxonomy:/name@rank/...` syntax. Replaces generic string-based path matching in predicates with structured `TaxPath` and `TaxPattern` types, enforcing explicit anchor constraints and rank-aware semantics. Updates filtering documentation to clarify optional leading slashes and segment-boundary matching rules.
2026-06-22 10:24:04 +02:00
Eric Coissac c694e1f2b0 feat: add benchmark pipeline, expose APIs, and enforce strict paths
Introduces a Make-based orchestration for simulating, indexing, merging, filtering, and verifying k-mer counts and presence. Exposes internal builder and iterator APIs publicly, enforces mandatory leading slashes for predicate patterns, registers the `obitaxonomy` crate, and updates tooling configurations alongside documentation.
2026-06-22 10:18:33 +02:00
Eric Coissac 280ca1f5a3 feat: add optimized new_ones constructor for all-ones bit vectors
Introduces `new_ones` and `add_col_ones` methods to directly initialize all-ones bit vectors and matrix columns. This replaces redundant initialization sequences that created zero-filled structures and applied bitwise NOT, with a single pass that writes contiguous 0xFF bytes to disk. The change eliminates inversion overhead, streamlines test setup, and improves performance for filter mask intersection logic while preserving identical semantics.
2026-06-22 10:00:01 +02:00
Eric Coissac 9abb2db92f refactor: replace explicit bit-setting loops with optimized bulk operations
Refactor bitmatrix, colgroup, and layer modules to replace manual iteration with concise `or_where` predicates and bulk inversion calls. This simplifies the codebase and leverages optimized internal implementations for improved performance.
2026-06-22 09:56:41 +02:00
Eric Coissac 7c1efa9cbb feat: add vectorized column filters and optimize partitioner iteration
Adds `FilterMask` and conditional bitwise methods (`*_where`) to `obicompactvec` for composable column-based slot filtering. Extends `obikpartitionner` with a `MatrixGroupOps` trait and `column_mask_expr` method to express aggregate constraints as vectorized masks. Refactors matrix builder management into a unified `Builders` enum and introduces `try_compute_combined_mask`, enabling O(1) slot checks and skipping unnecessary row reads during partitioning and rebuilding passes.
2026-06-22 09:54:51 +02:00
Eric Coissac 4c4524766c feat(matrix): add partial group reductions and column persistence
Expands MatrixGroupOps with partial_group_min/max helpers for bitwise reductions and introduces add_col_from methods to persist external vectors as matrix columns. Refactors column aggregation in the partitioner to leverage these group operations directly, replacing iterative row processing with simplified builder lifecycle management and explicit metadata serialization.
2026-06-22 09:49:04 +02:00
Eric Coissac 7eea71fdcd docs(obicompactvec): update API docs and algorithm descriptions
Replace trait-based API documentation with concrete, zero-copy view structs and update all associated diagrams. Refine algorithmic descriptions for sentinel handling, overflow stores, and bulk operations. Clarify temporary file lifecycles and group-chunking strategies to support memory-efficient parallel aggregation.
2026-06-22 09:46:19 +02:00
Eric Coissac f91c5a3f79 refactor(obicompactvec): unify bit and int vector slice views
Refactors column and matrix access to use unified `BitSliceView` and `IntSliceView` abstractions, replacing legacy `PackedCol`/`IntColView` types. Introduces `BitSlice`/`IntSlice` traits for zero-copy, trait-based bitwise and arithmetic operations across persistent and temporary vector types. Removes deprecated in-memory `MemoryBitVec` and `MemoryIntVec` implementations and their tests, while updating dependent crates to use the new view-based API and `BitSliceMut` trait.
2026-06-17 23:51:32 +02:00
Eric Coissac fb4962c4fe refactor: replace in-memory vectors with temp-file-backed storage
Introduces `TempCompactIntVec` and `TempBitVec` as temporary, file-backed intermediates to replace eager in-memory vectors, enabling OS-level paging under memory pressure. Updates the `MatrixGroupOps` trait to return `io::Result` types, allowing proper error propagation and supporting chunked accumulation for large column groups. Includes builder patterns with `.freeze()` finalization, automatic `TempDir` cleanup on drop, and necessary test updates to handle the new fallible signatures. Also fixes `Cargo.toml` section ordering.
2026-06-17 23:36:15 +02:00
Eric Coissac 1d38d87ff9 Add column group operations and mask_with trait
Introduce the `ColGroup` struct and `MatrixGroupOps` trait to manage named subsets of column indices and perform additive aggregations (count, sum, any). Implement these operations for `PersistentBitMatrix` and `PersistentCompactIntMatrix`, applying size-optimized branches for presence counts and direct accumulation for small groups. Additionally, add a `mask_with` trait method that efficiently zero-sets elements based on a mask, optimized for sparse masks with O(n_zeros) complexity. Include comprehensive tests covering overflow handling, slot masking, and result additivity across partitioned data.
2026-06-17 23:28:52 +02:00
Eric Coissac 93559c3294 feat: introduce unified column view types for bit and int matrices
This commit introduces `BitColView` and `IntColView` to abstract over Columnar and Packed storage formats, implementing `BitSlice` and `IntSlice` for uniform column access. It adds `col_view()` accessors to `PersistentBitMatrix` and `PackedCompactIntMatrix`, explicitly panicking on implicit variants. The new types are publicly re-exported, and unit tests are added to validate per-element retrieval, aggregation methods, and parity with the original columnar representation.
2026-06-17 23:24:11 +02:00
Eric Coissac 1f0d77d5bf docs: document compact vector implementation with Mermaid diagrams
Add Mermaid diagrams to visualize the trait hierarchy, compact int storage layout, and SIMD-vectorizable arithmetic operations for MemoryIntVec and PersistentCompactIntVec. Also document concrete type structures and planned layer/partition composition rules to improve documentation clarity.
2026-06-17 23:20:55 +02:00
Eric Coissac eeba43ac4f docs: add technical reference for obicompactvec module
Document the two-tier compact integer encoding, BitSlice/IntSlice trait hierarchy, and SIMD-friendly O(n+k) algorithms. Include details on concrete memory and persistent vector types, matrix aggregation traits, and planned group-filtering APIs.
2026-06-17 23:19:31 +02:00
Eric Coissac 7ed7b26039 perf: optimize vec arithmetic and add overflow tests
Refactor `cmp_scalar`, `min`, `max`, `add`, and `diff` to operate directly on the primary byte array, deferring overflow slot resolution to a secondary pass. This eliminates HashMap lookups in the hot path and enables SIMD vectorization. Add six unit tests to validate correct promotion and demotion between storage slots when values cross the 255 threshold.
2026-06-17 23:18:18 +02:00
Eric Coissac 26de90f18d feat: add iteration and aggregation to compact int vec
Implemented `sum()`, `count_nonzero()`, and `iter()` to complete the numeric vector interface. The builder now computes aggregate values across memory-mapped regions and overflow entries, while the reader delegates these operations to its inherent methods. The iterator provides zero-copy access to underlying `u32` elements.
2026-06-17 23:15:56 +02:00
Eric Coissac 497d250d8a refactor: replace byte-level bit iteration with 64-bit words
Refactor `BitIter` to process `u64` chunks using word-aligned shifts instead of byte-level operations. Introduce a dedicated `MemoryBitIter` for `MemoryBitVec`, updating its `iter()` and `IntoIterator` implementations accordingly. Hide `MemoryBitIter` from the public API to narrow the crate's interface, while leveraging explicit alignment guarantees for safer and more efficient bit extraction.
2026-06-17 23:11:12 +02:00
Eric Coissac aa98e82875 refactor: introduce PackedIntCol view and use iterators
Centralizes overflow handling and improves modularity by replacing manual mmap indexing and row loops with composable iterator patterns. This change leverages Rust's iterator traits for efficient, idiomatic column traversal while encapsulating data access in a dedicated view struct.
2026-06-17 23:09:18 +02:00
Eric Coissac 5ff5b04d2d refactor: replace manual bit ops with BitSlice traits
Refactors bit manipulation and distance calculations to leverage standardized `BitSlice` traits, replacing manual byte/word logic with safer, reusable methods. Extends `IntSlice` and `IntSliceMut` traits to expose direct memory-mapped access and overflow management, enabling efficient bulk data extraction and serialization. Replaces manual bit-shifting loops with optimized table-based unpacking and adds population count and distance metric methods for improved performance. Updates `PersistentBitVecBuilder` with file tracking and safe flushing, and aligns test imports with new trait bounds.
2026-06-17 15:28:44 +02:00
Eric Coissac df7b400fda perf: optimize aggregation with byte-level helpers and direct mmap
Introduce `byte_sum` and `byte_count_nonzero` to efficiently aggregate compact-int byte slices, bypassing per-element decoding and overflow map lookups. Refactor `sum()` and `count_nonzero()` across the matrix, reader, and traits modules to use direct memory-mapped slice iteration and idiomatic Rust iterators. Additionally, expose `MemoryIntIter` publicly and implement `IntoIterator` and `IntSlice` for `MemoryIntVec` to enable standard iteration and delegate aggregation to the new helpers.
2026-06-17 15:21:21 +02:00
Eric Coissac d1717688d2 refactor: extract matrix helpers and improve bit iteration ergonomics
Refactor parallel matrix construction by extracting reusable `pairwise_matrix` and `pairwise2_matrix` helpers, and consolidate binary record deserialization into dedicated parsing functions. Add `set` and `iter` methods to `BitSliceMut` and `MemoryBitVec` for ergonomic bit manipulation and iteration. Standardize JSON field extraction via `meta::field`, expose `MemoryBitIter`, and improve test reliability by automatically cleaning up temporary directories.
2026-06-17 15:15:39 +02:00
Eric Coissac cde6457eea feat: add memory vectors, slice traits, and column extraction methods
Introduce `MemoryBitVec` and `MemoryIntVec` for efficient in-memory storage with hybrid compression and overflow handling. Implement `BitSlice`, `BitSliceMut`, `IntSlice`, and `IntSliceMut` traits across persistent and memory-backed types to enable generic slice operations and bitwise/arithmetic overloads. Add `col_persist` and `col_as_memory` methods to `BitMatrix` and `IntMatrix` for efficient column extraction. Align with the new single-pass rebuild architecture by supporting fast kmer filtering and matrix rebuilding. Includes comprehensive tests and profiling instrumentation for the packing phase.
2026-06-17 15:03:18 +02:00
Eric Coissac b6fcbc545f refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:53:31 +02:00
coissac 9578f991f4 Merge pull request 'Push pslsukyowzrp' (#32) from push-pslsukyowzrp into main
Reviewed-on: #32
2026-06-15 16:29:24 +00:00
Eric Coissac 1cd7916e06 refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:29:04 +02:00
Eric Coissac bc92dc4592 refactor: restructure partitioner with shared utilities and pipeline
This commit restructures the partitioner crate by extracting shared utilities and the `ColBuilder` enum into a new `common` module. It introduces a multi-phase `graph_pipeline` for constructing and materializing De Bruijn graphs, replacing manual graph construction in `index_layer`, `merge_layer`, and `rebuild_layer`. All layer workflows now use centralized `build_graph` and `materialize_layer` abstractions, with standardized error context strings for improved diagnostics.
2026-06-15 14:08:16 +02:00
coissac a9567ad023 Merge pull request 'Push rtnzuqxzmkon' (#31) from push-rtnzuqxzmkon into main
Reviewed-on: #31
2026-06-15 09:40:35 +00:00
Eric Coissac 4a64718fd1 perf: replace partition processing with adaptive NUMA worker pool
Replaces the previous partition processing logic with an adaptive, NUMA-aware multi-threaded worker pool that dynamically scales active threads based on real-time CPU efficiency. Introduces pre-spawned, CPU-pinned threads managed via crossbeam channels and Rayon to optimize memory bandwidth and core utilization. Adds a `max_workers()` accessor to aggregate maximum worker capacity across NUMA nodes and updates diagnostics to report active versus maximum worker counts.
2026-06-15 11:40:14 +02:00
Eric Coissac 7a87e911b6 feat: introduce NUMA-aware PartitionRunner for adaptive parallelism
Replace NUMA-naive Rayon loops and ad-hoc adaptive pools with a unified `PartitionRunner` that manages a NUMA-aware worker pool. The implementation uses pinned Rayon thread pools per node and activates dormant threads based on real-time CPU efficiency metrics. This standardizes partition-level parallelism, optimizes memory locality, and eliminates cross-socket traffic. Includes architecture documentation and updates mkdocs navigation.
2026-06-15 11:34:41 +02:00
coissac 313d73838a Merge pull request 'feat: add pipeline concurrency throttling and HPC build docs' (#30) from push-owwylwtskwzw into main
Reviewed-on: #30
2026-06-15 08:33:41 +00:00
Eric Coissac 175ea5bbd0 feat: add pipeline concurrency throttling and HPC build docs
Introduces a counting semaphore-based throttling mechanism to limit concurrent file I/O and pipeline processing. Replaces custom path wrappers with standardized `Throttled` types across `obikmer` and `obikpartitionner`, ensuring RAII-based resource cleanup and explicit backpressure. Additionally, documents how to redirect Cargo build artifacts to local scratch storage on HPC filesystems to prevent compilation slowdowns.
2026-06-15 10:33:23 +02:00
coissac c6ea0c53e3 Merge pull request 'feat: implement NUMA-aware worker pools for merge command' (#29) from push-wusvurukprsr into main
Reviewed-on: #29
2026-06-14 21:57:21 +00:00
Eric Coissac ea767376bd feat: implement NUMA-aware worker pools for merge command
Replaces the global Rayon pool with per-NUMA-node thread pools that pin worker threads to their respective nodes, leveraging Linux first-touch allocation to reduce cross-NUMA memory contention and improve cache locality. Integrates the `hwlocality` crate with a vendored build, includes graceful fallbacks for single-socket or non-Linux systems, and updates dependency constraints. Also adds installation and architecture documentation, and corrects parallelism detection in the partitioner.
2026-06-14 23:56:52 +02:00
coissac f1d76f3203 Merge pull request 'refactor(merge): extract adaptive worker spawn logic' (#28) from push-yzruqtyqvopm into main
Reviewed-on: #28
2026-06-13 12:56:34 +00:00
Eric Coissac c4071eb450 refactor(merge): extract adaptive worker spawn logic
Centralize inline spawn checks into a `should_spawn_worker` function with adaptive thresholds. The first worker spawns at <95% CPU efficiency, while subsequent workers only trigger if marginal efficiency gain exceeds 25% of the expected `1/n_workers` (minimum 3%). Also increases the spawn poll interval from 10s to 20s.
2026-06-13 14:56:01 +02:00
coissac 817b02cbc1 Merge pull request 'Push zkspuxlpumpw' (#27) from push-zkspuxlpumpw into main
Reviewed-on: #27
2026-06-13 11:25:12 +00:00
Eric Coissac 547cb72d76 refactor: Enforce Rayon parallelism and fix merge_layer concurrency
Updated memory guidelines and feedback docs to explicitly classify intra-partition phases as parallel, correcting prior assumptions of sequential execution. Refactored merge_layer.rs to wrap column builders in Arc<Mutex<ColBuilder>> and use Arc::try_unwrap for safe concurrent access, eliminating race conditions and preventing double-closes during pass2.
2026-06-13 13:24:55 +02:00
Eric Coissac 6d85387077 feat: add performance instrumentation and dynamic worker scaling
This change enhances observability and adaptability in the merge pipeline. Performance timing and debug logging are added to the De Bruijn graph and partition merge layers to track phase durations and pipeline metrics. The merge module replaces blocking receives with timed polls to sample CPU efficiency, dynamically spawning workers when utilization drops below a threshold. A new script is also introduced to parse merge debug logs and generate structured Markdown reports detailing throughput, phase breakdowns, and partition performance.
2026-06-13 13:21:53 +02:00
coissac fb5b53dca9 Merge pull request 'Push ooxwzorvsqvy' (#26) from push-ooxwzorvsqvy into main
Reviewed-on: #26
2026-06-13 09:59:07 +00:00
Eric Coissac fddf630772 style: apply consistent formatting and whitespace normalization
Applies consistent formatting, whitespace normalization, and indentation standardization to `debruijn.rs` and `merge.rs`. Reorganizes imports and downgrades a unitig traversal log from `info!` to `debug!`. No functional logic or runtime behavior is altered.
2026-06-13 11:58:20 +02:00
Eric Coissac bc14346f5f feat: add CPU-aware parallel worker pool for partition merging
Introduce CpuSample to measure process-level CPU efficiency and wall-clock time. Use crossbeam-channel to distribute partition merging tasks to a dynamic worker pool that scales based on CPU utilization, capped at half the available cores. Update diagnostics to track pool usage.
2026-06-13 11:58:20 +02:00
Eric Coissac fb8c6e427c refactor: pass Unitig objects directly instead of raw byte slices
Refactored `try_for_each_unitig` and related pipelines across `obidebruinj` and `obikpartitionner` to accept `Unitig` instances directly. This eliminates manual `Unitig::from_nucleotides()` conversions, simplifies the data flow, and reduces unnecessary allocation overhead.
2026-06-13 11:52:50 +02:00
Eric Coissac 1f336fe496 refactor: replace mutex with channels for parallel debruijn processing
Add `rayon` and `crossbeam-channel` dependencies to support concurrent execution. Replace the synchronous, mutex-protected closure pattern with a channel-based producer-consumer approach using `std::thread::scope`. This decouples unitig iteration from processing, eliminating lock contention and `Mutex` overhead while enabling parallel workloads.
2026-06-13 11:49:27 +02:00
Eric Coissac 5f98d2ef96 refactor: replace explicit collect with Unitig::from_nucleotides
Introduce a thread-local buffer to materialize nucleotide iterators into contiguous slices. Update `try_for_each_unitig` across the debruijn, index, merge, and rebuild layers to directly instantiate `Unitig` via `from_nucleotides()` instead of explicitly collecting iterators. This eliminates intermediate allocations and aligns test code with the new approach.
2026-06-13 11:47:06 +02:00
Eric Coissac 8b563d0804 refactor: migrate pipeline stages and improve graph processing
Refactored neighbor resolution to explicitly track unvisited indices for degree-1 nodes, updated display formatting, and added timing and debug logging to the degree computation routine. Migrated pipeline stages from eager vector returns to explicit flat implementations, enabling backpressure-aware streaming, configurable batch processing, incremental yielding, and progress tracking via a delta channel.
2026-06-13 11:44:17 +02:00
coissac 7208dcbb4a Merge pull request 'refactor: defer SrcLayerData lookups in RawBatch' (#25) from push-nxrynoorswrw into main
Reviewed-on: #25
2026-06-12 20:19:21 +00:00
Eric Coissac 2e69b0b7fe refactor: defer SrcLayerData lookups in RawBatch
Replace eager resolution of `Vec<u32>` values with an `Arc<SrcLayerData>` handle passed alongside `Vec<CanonicalKmer>`. This shifts the lookup logic to the subsequent transform step, reducing memory overhead and enabling shared, thread-safe access to the source layer data.
2026-06-12 22:18:57 +02:00
coissac 9ea1dff5d6 Merge pull request 'Push rwqsmuvystym' (#24) from push-rwqsmuvystym into main
Reviewed-on: #24
2026-06-12 19:33:20 +00:00
Eric Coissac b2c8373586 refactor: parallelize merge layer with WorkerPool pipeline
Replaces the synchronous sequential loop with a multi-threaded pipeline using `WorkerPool` and custom stage macros. Shared mutable state is wrapped in `Arc<Mutex<>>` for thread-safe updates, while pipeline errors are centralized via `Arc<Mutex<Option<String>>>` to propagate failures before thread join.
2026-06-12 21:32:53 +02:00
Eric Coissac ba49af6f9e refactor: parallelize merge and partition logic with obipipeline
Introduce the `obipipeline` dependency and refactor merge and partition logic to leverage parallel execution. Update `merge_partitions` to use rayon with dynamic memory budgeting and concurrency control via a pilot run. Refactor Pass 1 to concurrently read unitigs, filter kmers through a shared `LayeredMap`, and populate the graph safely. Simplify diagnostics to report total kmer counts and replace manual flags with graph length validation.
2026-06-12 21:32:04 +02:00
Eric Coissac 2bc189e962 feat: dynamically compute seed expansion based on RSS
Introduce a `peak_rss_bytes()` utility for accurate per-phase RAM measurement. Replace the genome-length heuristic with a dynamic seed expansion ratio based on actual RSS delta. Explicitly drop the `GraphDeBruijn` instance before MPHF construction to prevent resource contention and ensure proper memory management.
2026-06-12 16:39:38 +02:00
coissac db9c604199 Merge pull request 'feat: enhance memory budgeting and add rebuild diagnostics' (#23) from push-nptzpkomspkv into main
Reviewed-on: #23
2026-06-12 13:21:12 +00:00
Eric Coissac 52fd2cf801 feat: enhance memory budgeting and add rebuild diagnostics
This commit improves memory management by respecting Linux cgroup v1/v2 limits and introduces a configurable memory budget for the new `rebuild` subcommand to prevent OOM during index reconstruction. The rebuild process now supports filtering, compaction, and parallelization. Diagnostic capabilities are expanded with debug-level tracing for partition merges, k-mer expansion tracking, and utility flags for label renaming, matrix size breakdowns, per-genome counts, and partition distribution reporting. Accessor methods for active and remaining memory have also been added to the stats struct.
2026-06-12 15:20:38 +02:00
coissac 97e3fb9761 Merge pull request 'Push ylnwstyzqwrt' (#22) from push-ylnwstyzqwrt into main
Reviewed-on: #22
2026-06-12 10:10:03 +00:00
Eric Coissac b5e027f23b feat: add memory-aware parallel merge scheduling and CLI flags
Introduces a memory-aware scheduling strategy for parallel partition merging that replaces unbounded concurrency with a First-Fit Decreasing approach gated by a thread-safe `MemoryBudget` semaphore. An adaptive expansion factor, seeded by a sequential pilot run, dynamically caps concurrent workers to prevent hashbrown OOMs. Adds a `--budget-fraction` CLI flag to configure RAM allocation, enhances the CLI to accept multiple indexes, and introduces comprehensive partition diagnostics including memory utilization tracking, concurrency metrics, and statistical summaries with ASCII histograms. Updates documentation and navigation accordingly.
2026-06-12 11:44:10 +02:00
Eric Coissac f44fe042bc feat: add parallel k-mer counting and stats CLI
Introduces allocation-free `sum()` and `count_nonzero()` methods for compact integer vectors, extending the `ColumnWeights` trait with `partial_kmer_counts`. Adds parallel partition scanning to the k-mer index for computing per-genome distinct k-mer counts, and exposes a new `--stats` CLI flag to output these statistics as CSV.
2026-06-12 11:29:32 +02:00
coissac 94e0a370b3 Merge pull request 'Push tmpsxsztwpxl' (#21) from push-tmpsxsztwpxl into main
Reviewed-on: #21
2026-06-09 13:31:25 +00:00
Eric Coissac 970460be42 refactor: rename rebuild subcommand to filter
Rename the `rebuild` CLI subcommand to `filter` to better reflect its primary purpose of row-level selection and k-mer filtering. Update all associated CLI arguments, logging, error messages, and module registrations accordingly. Introduce a dedicated `Rebuild` subcommand for index compaction, fully decoupling it from the filtering logic. Also refine related documentation to align with the new naming and semantics.
2026-06-09 15:26:37 +02:00
Eric Coissac e66adef23d feat: add select command for genome column projection and aggregation
Introduces the `select` CLI command to project and aggregate genome-level k-mer data by column. Adds `filter` as an alias for `rebuild`. The implementation uses parallel partition processing, supports metadata-driven grouping with configurable aggregation operators, and performs atomic in-place rewrites or filtered exports. Updates documentation and navigation accordingly.
2026-06-09 15:09:47 +02:00
coissac b0dab452f6 Merge pull request 'refactor: optimize dump partition iteration and add progress tracking' (#20) from push-xqswlxlvmyrq into main
Reviewed-on: #20
2026-06-09 09:34:13 +00:00
Eric Coissac db730e9cf6 refactor: optimize dump partition iteration and add progress tracking
Refactor partition iteration to support a generic `on_partition` callback executed after each parallel partition completes. Split the logic into bounded and unbounded paths; the bounded path uses an `AtomicUsize` to enforce row limits, while the unbounded path eliminates atomic contention to improve throughput. Additionally, integrate a progress bar into the dump command by passing an increment callback to `idx.dump()`, ensuring proper initialization and cleanup.
2026-06-09 11:07:48 +02:00
coissac f65ecd19cc Merge pull request 'Push lrwmyplxxzkn' (#19) from push-lrwmyplxxzkn into main
Reviewed-on: #19
2026-06-09 08:28:20 +00:00
Eric Coissac 7dd8db1409 docs: document conservative rounding strategy for filtering thresholds
Specifies that minimum bounds use ceiling and maximum bounds use floor to enforce strictness. Clarifies that the implementation avoids explicit rounding by directly comparing integer counts against floating-point fractions, which is mathematically equivalent.
2026-06-09 10:26:21 +02:00
Eric Coissac ce45e2fbe1 refactor: centralize k-mer filtering logic and add validation
Refactor shared `FilterArgs` and `build_group_filter` to return a `Result` with explicit validation for fraction bounds, min/max ordering, and count constraints. Update conditional defaults for `--min-frac` and `--max-outgroup-count` to depend on explicit quorum flags, preventing silent configuration conflicts. Update documentation and MkDocs navigation to reflect the new centralized k-mer filtering system across `rebuild`, `dump`, and `unitig` commands.
2026-06-09 10:22:25 +02:00
Eric Coissac 2465cfbc4b Parallelize partition iteration using Rayon
Introduce thread-local `Vec<u8>` buffers to eliminate concurrent I/O contention. Replace the mutable row counter with an `AtomicUsize` and `fetch_update` to enable lock-free early termination when the limit is reached. Collected chunks are then written sequentially to preserve partition ordering.
2026-06-09 10:04:25 +02:00
Eric Coissac d626d42ec7 feat: add --head and --presence-threshold to dump and distance
Introduces `--head N` to the `dump` command for early iteration termination and `--presence-threshold N` to the `distance` command for Jaccard filtering on count indexes. Updates filter defaults to adapt based on explicit ingroup/outgroup declarations. Fixes a Rust type mismatch in the unitig closure and updates partition iteration callbacks to return `bool` for proper early termination support. Documentation is updated accordingly.
2026-06-09 10:04:25 +02:00
coissac 650eea43b6 Merge pull request 'Push quqlpklvxsqx' (#18) from push-quqlpklvxsqx into main
Reviewed-on: #18
2026-06-08 18:15:01 +00:00
Eric Coissac eb7805c747 feat: add configurable presence threshold to kmer distance
Introduce a `--presence-threshold` CLI argument (default: 1) and update `KmerIndex::distance` to accept a `presence_threshold` parameter. This replaces hardcoded zero thresholds, enabling configurable filtering of low-abundance kmers during Jaccard distance calculations.
2026-06-08 20:14:33 +02:00
Eric Coissac 1ec65922df feat: implement parallel pairwise distance matrices
Introduces parallelized pairwise distance matrix computation for Jaccard, Hamming, Bray-Curtis, Euclidean, and Hellinger metrics across `Columnar`, `Packed`, and `Implicit` matrix variants. Adds trait methods and convenience wrappers, safely handles normalization and zero-denominator edge cases, and updates test suites to import required traits for validation.
2026-06-08 20:08:09 +02:00
Eric Coissac 09d9e21744 feat: integrate tracing and enhance bit matrix operations
Add the `tracing` crate to `obidebruinj`, `obisys`, and resolve it in `Cargo.lock`. Replace `eprintln!` statements with structured `debug!` and `info!` macros. Introduce a `TracedBar` wrapper for progress bars and enhance the `Stage` lifecycle to emit structured events for timing, memory metrics, and swap warnings. Add a progress spinner for unitig degree computation. Extend `PersistentBitMatrix` with columnar bit-vector operations and parallel distance methods, enabling uniform distance computations across all storage layouts while replacing previous panics with dimension-based fallbacks.
2026-06-08 19:55:06 +02:00
coissac 3f47e22083 Merge pull request 'Push pvqkqxlkkwry' (#17) from push-pvqkqxlkkwry into main
Reviewed-on: #17
2026-06-06 04:44:10 +00:00
Eric Coissac 03c7bb0b99 Relax unitig assertion in debruijn test
Replace the strict `unitigs.len() == 1` assertion with a non-empty check to allow multiple unitigs. Update the test comment to describe the general non-repetitive sequence recovery principle instead of a specific example. The core k-mer roundtrip validation logic remains unchanged.
2026-06-06 06:41:45 +02:00
Eric Coissac b39eee688a refactor(debruijn): unify graph traversal with WalkState iterator
Replaces deeply nested branching with early returns and `then_some`. Introduces a cycle-detecting `find_chain_start` method and updates `UnitigNucIter` to use step-based iteration with atomic node claiming. This eliminates nested iterators and redundant state management, improving code readability and maintainability.
2026-06-06 06:38:28 +02:00
Eric Coissac 95b3461405 refactor: centralize graph traversal logic in walk
Refactor `leavable` and `reachable` to eliminate duplicated graph traversal logic by mutually delegating via `WalkState`. `leavable` now returns `self.walk(graph).is_some()`, while `reachable` delegates to the inverted `direct` state's `leavable` check. This centralizes kmer extension and visited-state validation in `walk`, simplifying control flow and reducing code duplication.
2026-06-06 06:36:48 +02:00
Eric Coissac 952a21eef8 refactor: remove naked_asm and extract collect_unitigs helper
Remove the `std::arch::naked_asm` import as it is no longer required. Introduce a `collect_unitigs` helper to abstract nucleotide sequence extraction from `GraphDeBruijn`, and refactor the test suite to use it, eliminating repetitive collection code and standardizing graph iteration logic.
2026-06-06 04:33:59 +02:00
Eric Coissac 5c2f48535f refactor: rename compute_degrees and mark start nodes
Renames `compute_degrees` to `compute_degrees_and_mark_starts` across the De Bruijn graph and partitioner layers to consolidate degree calculation and start-node flagging. Introduces safe neighbor iteration methods and a debug validation block to verify graph consistency. Refactors unitig extraction to use sequential execution with a `Mutex` for safe error propagation. Fixes malformed and duplicated method calls, adds auto-generation of missing `meta.json` files, and ensures persistent matrix builders are explicitly closed to finalize metadata.
2026-06-05 19:48:59 +02:00
Eric Coissac 27088ab810 refactor: optimize unitig iteration and graph traversal
Switches unitig processing to a lazy, fallible `try_for_each_unitig` API across partitioner layers, reducing intermediate allocations and enabling proper error propagation. Refactors de Bruijn graph traversal into a two-pass algorithm with explicit node flags, named constants, and diagnostic logging. Introduces parallel chain processing and staged performance profiling for the unitig command, and adds a memory-efficient `FromIterator` implementation for packed nucleotide sequences.
2026-06-05 19:48:59 +02:00
coissac ea2c594c86 Merge pull request 'Push ruqusmkoyvwm' (#16) from push-ruqusmkoyvwm into main
Reviewed-on: #16
2026-06-05 08:41:08 +00:00
Eric Coissac d202ead385 feat: parallelize unitig extraction and FASTA output
Replace the non-atomic `set_visited` with atomic `fetch_or` bitmask operations to enable thread-safe node claiming. Introduce a two-phase extraction pipeline where `par_for_each_chain_unitig` builds chains in parallel and `for_each_remaining_unitig` sequentially handles residual cycles and junctions. Add `is_start` and `collect_from_start` to explicitly define unitig boundaries. Wrap `BufWriter` in a `Mutex` and use an `AtomicUsize` counter to ensure thread-safe concurrent FASTA output, refactoring the write logic into a shared closure for safe multi-threaded execution.
2026-06-05 10:33:52 +02:00
Eric Coissac 249998beed perf: add structured performance profiling for unitig stages
Wraps graph construction, degree computation, and unitig enumeration phases with `Stage` start/stop calls. Intervals are recorded in a `Reporter` instance and printed upon completion to provide granular timing metrics for each computational stage.
2026-06-05 10:28:45 +02:00
Eric Coissac 2f29ee2240 feat: Add parallel execution and thread-safe graph operations
Integrate rayon to enable parallel processing of k-mer partitions and degree computation. Replace Cell with AtomicU8 to ensure thread-safe node state management, and add a merge method for combining disjoint graphs. Additionally, introduce progress tracking utilities and a test-utils feature flag for development dependencies.
2026-06-04 23:22:55 +02:00
Eric Coissac edd5e3f8ee feat: add bits-per-kmer diagnostic and stats module
Introduce a `stats` module to compute normalized storage efficiency metrics. The new `KmerIndex::bits_per_kmer()` method parallelizes disk I/O across partitions to aggregate file sizes for MPHF, evidence, and matrix components. Publicly export `IndexBitsPerKmer` and add a `--bits-per-kmer` CLI flag to trigger the diagnostic routine and print detailed statistics.
2026-06-04 23:17:17 +02:00
Eric Coissac bb7adc1154 docs: expand kmer indexing, filtering, and merging documentation
Expands MkDocs navigation and documentation for evidence elimination, the merge command, and kmer filtering. Refactors kmer representation to a generic `KmerOf<L>` type with a bitwise reverse complement algorithm. Unifies MPHF construction, introduces approximate fingerprint-based indexing, and updates the pipeline, chunkreader, and storage layouts. Adds code coverage reports and clarifies architectural invariants for improved maintainability.
2026-06-04 22:59:41 +02:00
Eric Coissac 9306ec1c56 perf: Replace manual window tracking with monotonic deque algorithm
Eliminates intermediate allocations by computing per-genome window minimums (`win_min`) directly. Unifies the `z ≤ 1` and `z > 1` branches into a single buffer-reused accumulation loop, efficiently validating k-mer presence.
2026-06-04 21:37:09 +02:00
Eric Coissac 712a03a3a6 refactor: replace unitig extraction with de Bruijn graph pipeline
This change replaces direct partition-based extraction with a pipeline that reconstructs a de Bruijn graph from filtered k-mers. It introduces `FilterArgs` for k-mer selection, collects filtered k-mers in parallel into a `GraphDeBruijn`, computes node degrees, and enumerates unitigs from the graph for output instead of reading pre-computed partition files.
2026-06-04 21:32:49 +02:00
Eric Coissac 3e62ffe010 feat: add selective k-mer filtering to dump and rebuild commands
Add the `obidebruinj` dependency and introduce `FilterArgs` CLI arguments for ingroup/outgroup predicates and count/fraction thresholds. Extend `GroupFilterParams` to support outgroup filtering, and integrate the filter collection into `KmerIndex::dump` and `rebuild` commands. This enables selective k-mer filtering during index operations and CSV exports.
2026-06-04 21:29:58 +02:00
Eric Coissac a1499e6153 feat: add kmer filtering and refactor layer iteration
Introduce a `passes_all` utility to validate kmer rows against multiple filters using short-circuit logic. Integrate a `filters` parameter into the iteration functions to conditionally emit kmers based on filter results. Extract repetitive layer traversal and filtering into an `iter_src_layers` helper, refactoring Pass 1 and Pass 2 to eliminate duplication. Additionally, add a debug conditional to the dump output to include partition and layer metadata alongside kmer sequences.
2026-06-04 21:08:15 +02:00
Eric Coissac 476c7a6394 feat: add metadata-driven k-mer filtering for rebuild command
Introduces a metadata-driven filtering system for the rebuild command, classifying genomes into ingroup and outgroup categories using exact, inequality, and hierarchical path predicates. Implements a GroupQuorumFilter to enforce configurable presence thresholds and fraction constraints per group. Refactors the command to replace global quorum filters with this unified approach, converts the presence flag to a threshold parameter, and adds corresponding documentation and MkDocs navigation.
2026-06-04 21:01:58 +02:00
coissac edc18b4908 Merge pull request 'Push rrwpnquuzsvr' (#15) from push-rrwpnquuzsvr into main
Reviewed-on: #15
2026-06-03 17:04:25 +00:00
Eric Coissac 02cb30c0ef feat: add obisys crate for standardized CLI progress reporting
This commit introduces the `obisys` crate, which wraps `indicatif` to provide reusable `spinner` and `progress_bar` utilities with consistent styling and tick intervals. It refactors progress reporting across `obikindex`, `obikpartitionner`, and `obikmer` to use these shared functions, eliminating inline UI configuration and ensuring uniform terminal feedback.
2026-06-03 19:03:59 +02:00
Eric Coissac 4677d6f177 refactor: improve resource cleanup and index packing
Explicitly close file handles and remove temporary artifacts after serialization to prevent disk space leaks. Additionally, compact internal matrix structures immediately upon loading the KmerIndex to improve memory efficiency and prepare for downstream operations.
2026-06-03 15:35:56 +02:00
coissac 7a29ca6305 Merge pull request 'Push ywwwypqxrtmy' (#14) from push-ywwwypqxrtmy into main
Reviewed-on: #14
2026-06-03 13:18:41 +00:00
Eric Coissac bba5147f0f fix: account for k-mer overlap in total_bases calculation
Introduces a `kmer_overlap` variable (`k-1`) and modifies the `total_bases` accumulation to subtract this overlap from each sequence's length. This ensures the base count accurately reflects only valid k-mer starting positions rather than raw sequence length.
2026-06-03 15:11:48 +02:00
Eric Coissac bfe0cb4b82 feat: integrate obikseq to configure global k-mer and minimizer sizes
This change adds the `obikseq` crate as a local dependency and inserts `set_k` and `set_m` calls across index creation and command modules. By synchronizing the runtime's global k-mer and minimizer dimensions with the loaded index parameters, downstream sequence processing and partitioning operations now consistently use the correct structural constraints.
2026-06-03 14:31:14 +02:00
Eric Coissac 173ac9fb42 feat: introduce packed matrix storage and layer metadata
Unifies bit and integer matrix storage into `PersistentBitMatrix` and `PersistentCompactIntMatrix` enums, supporting both columnar and memory-mapped single-file layouts. Introduces `LayerMeta` to persist layer dimensions as `layer_meta.json`, enabling correct initialization of implicit presence matrices. Adds CLI commands (`pack` and `--upgrade-index`) to convert existing columnar indices to the compact format and backfill missing metadata. Updates partitionner and layered map logic to use the new persistent builders, optimized memory allocation, and auto-detected storage backends.
2026-06-03 14:16:04 +02:00
Eric Coissac de1a41810a perf: enable zero-allocation queries and memory-mapped indexes
Introduce zero-allocation row extraction and query result buffers across `obicompactvec` and `obikpartitionner` to eliminate per-kmer heap allocations. Replace in-memory MPHF deserialization with memory-mapped, zero-copy views to reduce runtime memory footprint. Add configurable I/O chunking, a RAM-aware `--chunk-size` parameter, and system memory monitoring via the new `sysinfo` dependency. Re-export `PreloadedIndex` for external consumers.
2026-06-03 10:24:12 +02:00
Eric Coissac 1661dd6b1c feat: introduce preloaded index cache and thread-safe progress tracker
Introduce `PreloadedIndex` to cache partition indices and eliminate redundant I/O during repeated queries. Refactor the query pipeline to route through this pre-loaded index, and expose it publicly in `obikpartitionner`. Additionally, add a thread-safe, lazily-initialized `MultiProgress` singleton for improved progress tracking.
2026-06-03 09:42:18 +02:00
Eric Coissac 2ebc5f0d75 chore: add logging infrastructure to merge routine
Adds comprehensive logging for source metadata, merge modes, and forced approximation detection. Introduces `format_evidence` and `is_trivial` helpers to format `IndexMode` variants and identify single-genome presence indices. The core merge algorithm remains unmodified, with all changes focused on enhanced runtime observability.
2026-06-01 15:23:37 +02:00
coissac 4fd0eb989f Merge pull request 'Push pnxswqpxlyso' (#13) from push-pnxswqpxlyso into main
Reviewed-on: #13
2026-06-01 12:45:46 +00:00
Eric Coissac add6d7f873 enforce uniform index mode and optimize base index selection
Adds validation to ensure all input sources share the same `IndexMode`. Introduces base index selection logic that prioritizes approximate or hybrid evidence and maximizes base size to minimize newly indexed k-mers. Includes helper functions for triviality evaluation, cumulative size calculation, and mode consistency checks.
2026-06-01 14:43:51 +02:00
Eric Coissac 0350ca855b refactor: streamline merge pipeline and MPHF indexing
Replace mphf.find() with direct mphf.index() calls to eliminate absence checks and fallback vectors. Introduce a lightweight MphfOnly wrapper for faster index loading, and standardize k-mer iteration across merge and rebuild layers. Update IndexMeta configuration and n_new calculation to leverage MPHF cardinality, streamlining the overall merge pipeline.
2026-06-01 14:37:35 +02:00
Eric Coissac 1e2115a1b0 docs: Update README to reflect new indexing workflow
Replace the documented direct combined indexing command with a two-step workflow. This involves building separate exact indexes per genome, merging them into a single multi-genome index via `obikmer merge`, and keeping the approximate index conversion unchanged.
2026-06-01 13:56:48 +02:00
Eric Coissac 657f964dda refactor: abstract k-mer types and fix bit alignment
Abstracts k-mer storage using a `RawKmer` alias and `KMER_BITS` constant to simplify bit manipulation and enable future extension to larger types. Updates bit-shifting and masking logic across `kmer.rs` and `packed_seq.rs` to prevent overflow and improve type safety. Adapts the MPHF layer to iterate over indexed canonical k-mers with explicit slot bounds validation and bit-level encoding. Fixes test suite compilation errors by correcting method names, adding tuple destructuring, and passing the required `IndexMode::Exact` parameter.
2026-05-31 20:46:49 +02:00
Eric Coissac 8b57c91ab7 feat: add iter_canonical_kmers iterator and tests
Implements `iter_canonical_kmers` in `unitig_index` to yield canonical kmers by traversing unitig chunks. Includes unit tests to verify that the iterator exclusively yields canonical kmers and matches `iter_kmers` in count and canonical equivalence.
2026-05-30 16:30:02 +02:00
coissac 728476a0a6 Merge pull request 'Push rxrxptuxltlp' (#12) from push-rxrxptuxltlp into main
Reviewed-on: #12
2026-05-30 14:03:13 +00:00
Eric Coissac 8a0b898b4b docs: clarify query pipeline, Findere trick, and input formats
Fix a stray prefix in the README heading and update documentation to reflect the query pipeline's operation on `s-mers` (`s = k - z + 1`) with post-partition z-window filtering. Clarify the Findere trick, including k-mer size reduction, consecutive match requirements, and false positive rate calculations. Additionally, expand input format documentation to cover supported file extensions, gzip compression, recursive directory handling, and `query` command specifications.
2026-05-30 15:59:12 +02:00
Eric Coissac 708b0abf9b refactor: aggregate query results at sequence level
Refactor the query pipeline to buffer partition outputs into a per-sequence `seq_results` vector, deferring final accumulation until all partitions complete. This ensures global position ordering before computing k-mer presence, counts, and coverage statistics. Additionally, removes a resolved TODO and documents a known BLAST false-positive issue where chloroplast and bacterial contaminants yield unrealistic high-confidence matches.
2026-05-30 07:18:54 +02:00
coissac 3138f6382c Merge pull request 'Push nvyqwlpspwvl' (#11) from push-nvyqwlpspwvl into main
Reviewed-on: #11
2026-05-29 07:21:58 +00:00
Eric Coissac 86b88acb95 feat: implement approximate k-mer indexing and optimize query
Enable approximate k-mer indexing via the `--approx` flag, computing an effective k-mer size of `k - z + 1` and configuring the appropriate indexing mode with validated probabilistic parameters. Refactor the Findere z-window filter in the query command to improve performance and correctness by replacing the precomputed vector with a lazy closure, optimizing cache locality, and fixing a variable naming bug.
2026-05-29 09:20:44 +02:00
Eric Coissac be0e8f1041 refactor(query): parallelize query execution with obipipeline
Extracts chunk processing into a dedicated function and introduces a QueryData enum with unsafe Send/Sync implementations to safely distribute Rope chunks across worker threads. Replaces nested iteration with a flat iterator and parallel block processing. Adds CLI argument parsing for presence, threshold, and detail flags to configure the pipeline.
2026-05-29 09:18:54 +02:00
Eric Coissac eaa52eaab5 feat: introduce nucstream abstraction and comprehensive test suite
Introduces a unified NucStream abstraction with NucPageCursor for byte-offset tracking and MIME-type dispatch to instantiate format-specific parsers. Exposes nuc_stream and open_nuc_stream APIs that return boxed, Send-compatible iterators. Additionally, adds a comprehensive test suite covering chunk boundary alignment, FASTA/FASTQ record parsing, sequence normalization, and edge cases such as CRLF line endings, @ in quality strings, and multi-slice rope processing.
2026-05-29 09:17:24 +02:00
Eric Coissac cfadf63bbc refactor: migrate pipeline to NucPage-based stream processing
Replace the existing chunk and Rope-based processing pipeline with a fixed-size NucPage architecture. Introduce a new nucstream module featuring buffer-pooled, in-place parsing that auto-detects and decompresses FASTA/FASTQ/GenBank inputs into normalized ACGT streams with k-mer overlap preservation. Update obikmer scatter and superkmer stages to consume NucPage iterators and cursor-based navigation, eliminating std::io::Read dependencies and optimizing memory management. Add a configurable max_open_files CLI argument and update implementation documentation to reflect the new record vs. stream reading paths.
2026-05-29 09:10:25 +02:00
Eric Coissac a4b57a96de feat: add streaming sequence reader and superkmer iterator
Introduce the `obiread` crate with a streaming byte normalizer that processes FASTA, FASTQ, and GenBank files using a 64 KiB ring buffer for O(1) memory usage. Integrate this crate into `obiskbuilder` to provide `SuperKmerStreamIter`, enabling memory-efficient superkmer traversal with rolling entropy and minimizer-based cut conditions.
2026-05-29 09:10:25 +02:00
Eric Coissac 0d9be53d1f feat: enforce runtime validation for kmer and minimizer parameters
Introduces `CommonArgs::validate()` to enforce strict constraints on `--kmer-size` (odd, 11–31), `--minimizer-size` (odd, 3–k−1), and `z` (strictly less than k). This validation is applied at the entry point of the `superkmer` and `index` commands to prevent invalid configurations, avoid palindromes, prevent u64 overflow, and ensure positive effective indexing sizes. Documentation is updated to reflect these runtime checks and immediate termination on invalid input.
2026-05-29 09:10:25 +02:00
coissac 82ec6aa1cf Merge pull request 'Push tklvqnrqtzpo' (#10) from push-tklvqnrqtzpo into main
Reviewed-on: #10
2026-05-26 15:41:05 +00:00
219 changed files with 51659 additions and 4732 deletions
Vendored
BIN
View File
Binary file not shown.
+35
View File
@@ -0,0 +1,35 @@
name: CI
on:
pull_request:
branches: ['main']
jobs:
build:
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
- name: Build
run: cargo build --release
- name: Test
run: cargo test --release
+127
View File
@@ -0,0 +1,127 @@
name: Release
on:
push:
tags:
- "v*"
jobs:
create-release:
runs-on: ubuntu-latest
outputs:
release_id: ${{ steps.create.outputs.release_id }}
steps:
- uses: actions/checkout@v4
with:
fetch-depth: 0
- name: Create Gitea release
id: create
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
TAG: ${{ github.ref_name }}
run: |
sudo apt-get update -qq && sudo apt-get install -y -qq jq
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
release_id=$(curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
-H "Authorization: token $GITEA_TOKEN" \
-H "Content-Type: application/json" \
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
echo "release_id=$release_id" >> $GITHUB_OUTPUT
build-linux-x86_64:
needs: create-release
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust + zigbuild
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
sudo apt-get update -qq && sudo apt-get install -y -qq jq
pip install ziglang --quiet --break-system-packages
$HOME/.cargo/bin/cargo install cargo-zigbuild
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
- name: Create musl C/C++ wrappers
run: |
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: linux-musl-cargo-
- name: Build static binary
env:
PKG_CONFIG_ALLOW_CROSS: "1"
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
strip /tmp/dist/obikmer-linux-x86_64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
build-macos-arm64:
needs: create-release
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v4
- name: Login to registry
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: macos-arm64-cargo-
- name: Build macOS binary
run: |
CID=$(docker create \
-w /src/src \
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
cargo build --release --target aarch64-apple-darwin --no-default-features)
docker cp . "$CID:/src"
docker start -a "$CID"
STATUS=$(docker wait "$CID")
mkdir -p /tmp/dist
docker cp "$CID:/src/src/target/aarch64-apple-darwin/release/obikmer" /tmp/dist/obikmer-macos-arm64
docker rm "$CID" > /dev/null
[ "$STATUS" -eq 0 ]
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
+14
View File
@@ -8,4 +8,18 @@ data-stress
*.pb
./**/*.json
*.bin
*.log
Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
benchmark/specimen_index_presence
benchmark/specimen_index_count
benchmark/global_index_presence
benchmark/all_specific
benchmark/global_index_count
benchmark/stats
benchmark/reference_index
benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obikmer"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- rust
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+26
View File
@@ -73,3 +73,29 @@ Lors de l'ajout de nouveaux fichiers Markdown dans `docmd/`, mettre à jour la s
---
Je continue à poser mes questions et à guider la discussion.
---
## MCP Tools
**Règle absolue : avant tout travail de code, appeler `mcp__serena__initial_instructions` pour charger les instructions Serena.**
### Hiérarchie des outils pour ce projet Rust
**Navigation et édition de code → serena en priorité**
- Trouver un symbole, une déclaration, les implémentations d'un trait : `mcp__serena__find_symbol`, `mcp__serena__find_declaration`, `mcp__serena__find_implementations`
- Trouver les usages d'un symbole : `mcp__serena__find_referencing_symbols`
- Diagnostics LSP (erreurs de compilation) : `mcp__serena__get_diagnostics_for_file`
- Vue d'ensemble d'un fichier : `mcp__serena__get_symbols_overview`
- Modifier le corps d'une fonction/impl : `mcp__serena__replace_symbol_body`
- Ne pas utiliser `cclsp` quand serena couvre le besoin
**Analyse architecturale → jcodemunch**
- Hotspots, couplage, dead code, dépendances entre modules
- Utiliser avant de refactorer une zone critique
**Raisonnement complexe → sequential-thinking**
- Décisions d'architecture, choix d'algorithme, trade-offs non triviaux
**Documentation de crates → context7**
- Toujours consulter avant d'utiliser une API de bibliothèque externe
+34
View File
@@ -22,6 +22,7 @@ $(MKDOCS): $(VENV)/bin/activate
mkdocs mkdocs-material \
mkdocs-mermaid2-plugin \
mkdocs-bibtex
$(PIP) install --quiet --upgrade InSilicoSeq
# ── obikmer binary ───────────────────────────────────────────────────────────
@@ -62,3 +63,36 @@ clean-doc:
.PHONY: clean
clean: clean-doc
rm -rf $(VENV)
# ── release ───────────────────────────────────────────────────────────────────
CARGO_TOML := $(CARGO_DIR)/obikmer/Cargo.toml
.PHONY: bump-version
bump-version:
@current=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
if [ -n "$(RELEASE)" ]; then \
new_version="$(RELEASE)"; \
else \
major=$$(echo $$current | cut -d. -f1); \
minor=$$(echo $$current | cut -d. -f2); \
patch=$$(echo $$current | cut -d. -f3); \
new_patch=$$((patch + 1)); \
new_version="$$major.$$minor.$$new_patch"; \
fi; \
echo "Version: $$current -> $$new_version"; \
sed -i.bak "s/^version = \"$$current\"/version = \"$$new_version\"/" $(CARGO_TOML) && \
rm $(CARGO_TOML).bak
.PHONY: release
release: bump-version
@jj auto-describe
@jj git push --change @
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
tag_msg="$${notes:-Release v$$new_version}"; \
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
git push origin "v$$new_version"
+123 -1
View File
@@ -1 +1,123 @@
toto
# obikmer
`obikmer` is a Rust toolkit for indexing, querying, and comparing DNA sequences
represented as sets of k-mers. It targets individual genome datasets (tens of
Gbases) with maximum efficiency in computation, memory, and disk usage.
## Key principles
**Compact k-mer encoding.** Each k-mer is stored in a `u64` at 2 bits/base.
k is odd, k ∈ [11, 31], fixed at runtime. The canonical form `min(kmer, revcomp(kmer))`
halves the effective space by collapsing both strands.
**Superkmer-based partitioning.** Sequences are decomposed into superkmers —
maximal runs of k-mers sharing the same minimizer. Superkmers route naturally to
partitions via the minimizer hash, enabling partition-parallel indexing and querying
with no cross-partition communication.
**Layered MPHF index.** Each partition holds a stack of layers. Each layer is a
minimal perfect hash function (MPHF) over the k-mers of one input genome, paired
with a per-genome presence/count matrix. Queries scatter k-mers to their partition,
probe each layer in order, and aggregate results.
**Approximate indexing (Findere).** With `-z Z`, the index stores k-mers of size
`s = k − z + 1` instead of k. At query time, results are produced at size s, then
a per-genome sliding window of size z aggregates z consecutive s-mer hits into one
confirmed k-mer answer. This reduces the false-positive rate from `1/2^b` per s-mer
to `1/2^(b·z)` per k-mer, at the cost of z−1 unconfirmed positions at each sequence
break. The aggregation window spans the full query sequence, not individual superkmers,
to avoid false negatives at superkmer boundaries.
**Multi-genome.** A single index can hold any number of genomes. Each k-mer slot
carries a per-genome count or presence vector. Distance matrices, NJ/UPGMA trees,
and classification are derived from these vectors without rebuilding the index.
## Input formats
Command Formats accepted
─────────────────── ──────────────────────────────────────────────────────────────
index, superkmer FASTA (.fa .fasta), FASTQ (.fq .fastq), GenBank flat file
(.gb .gbk .gbff), all optionally gzip-compressed.
Directories expanded recursively. Streaming stdin via -.
query FASTA, FASTQ, optionally gzip-compressed. Stdin via -.
Non-ACGT characters act as hard breaks between k-mer segments in all formats.
## Commands
Command Role
───────── ────────────────────────────────────────────────────────────────────
index Build a genome index from sequence files.
Runs scatter → dereplicate → count → layered MPHF.
Resumes automatically if interrupted.
merge Merge multiple independently built indexes into one.
Schedules partitions largest-first under a memory budget semaphore
to avoid OOM on machines with many cores. The worst partition runs
alone first to calibrate the expansion estimator; subsequent
partitions run in parallel within the budget.
--budget-fraction F fraction of available RAM to use as budget
(default 0.5; reduce if OOM persists).
filter Filter and compact an existing index: apply count thresholds,
drop layers, rewrite as a single-layer index.
reindex Convert evidence in-place across all layers:
exact (evidence.bin) ↔ approximate (fingerprint.bin).
Does not touch the MPHF or unitigs.
query Query an index with FASTA/FASTQ sequences.
Annotates each sequence with per-genome k-mer match counts
and optional per-position coverage vectors (--detail).
Parallel over sequence chunks.
distance Compute a pairwise Bray-Curtis or Jaccard distance matrix
between all indexed genomes.
Optionally outputs a Newick NJ or UPGMA tree.
annotate Add or update genome metadata (taxonomy, etc.) from a CSV
file; or dump the current metadata as CSV.
estimate Dry-run: resolve and print approximate-index parameters
(z, evidence bits b, FP rates) given any two of (b, z, fp).
Does not touch any index.
dump Dump all indexed k-mers as CSV with per-genome counts or
presence flags.
superkmer Extract superkmers from a sequence file and write to stdout.
Diagnostic / pipeline use.
unitig Dump the unitig sequences stored in a built index. Debug use.
utils Miscellaneous utilities.
--new-label NEW=OLD rename a genome label in-place.
--bits-per-kmer print MPHF / evidence / matrix size breakdown.
--stats per-genome k-mer counts as CSV.
--partition-stats partition size distribution across one or more
indexes (markdown report to stdout). Useful to
diagnose minimizer imbalance before a large merge.
--csv FILE write per-(partition, source) raw data to FILE
(used with --partition-stats).
## Quick start
```sh
# Build an exact index for each genome independently
obikmer index --kmer-size 31 --label genome_a genome_a.fa --output index_a/
obikmer index --kmer-size 31 --label genome_b genome_b.fa --output index_b/
# Merge into a single multi-genome index
obikmer merge --output index/ index_a/ index_b/
# Convert to approximate index (z=5, 8-bit fingerprints)
obikmer reindex --approx -z 5 --evidence-bits 8 index/
# Query reads
obikmer query index/ reads.fq.gz > annotated.fa
# Pairwise distances
obikmer distance index/ > distances.tsv
```
## Parameter constraints
Parameter Constraint
───────────────────── ──────────────
k (--kmer-size) odd, 11 ≤ k ≤ 31
m (--minimizer-size) odd, 3 ≤ m ≤ k−1
z (-z, --approx only) 1 ≤ z ≤ k−1
## Documentation
Extended architecture and implementation notes are in `docmd/`. Build with
`make doc` (requires Python + MkDocs Material).
+34
View File
@@ -24,3 +24,37 @@ Sauf qu'avec un index approximatif, les résultats seront approximatifs.
--detail et --mismatch à implementer
- status : affiche le statut de l'index
## Problème biologique sur l'identification des contaminants
Exemple de reads problématiques:
```
>LH00534:161:22WMGWLT4:4:1101:45301:1420 {"coverage":{"gbbct":[1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1]},"kmer_count":117,"kmer_strict_matches":{"gbbct":117}}
GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGATTTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACGCTTGCATCCTCTGTATTACCGCGGCTGCTGG
```
Par blast match une quantité invréssemblable de genomes chloroplastique avec un match de 100% (6554 hits pour Streptophyta)
mais aussi une quantité de sequences importantes à des OTU bactériennes (uncutured bacteria 115 hits) aussi avec 100% de similarité.
```
Uncultured bacterium clone Otu01032 16S ribosomal RNA gene, partial sequence
Sequence ID: KX996137.1Length: 440Number of Matches: 1
Range 1: 153 to 303GenBankGraphics
Next Match
Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
273 bits(302) 2e-69 151/151(100%) 0/151(0%) Plus/Minus
Query 1 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 303 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 244
Query 61 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 243 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 184
Query 121 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 151
|||||||||||||||||||||||||||||||
Sbjct 183 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 153
```
+230
View File
@@ -0,0 +1,230 @@
# Requires GNU Make >= 4.3 (grouped targets &:) — use gmake on macOS
BINARY := ../src/target/release/obikmer
VENV_PY := ../.venv/bin/python3
GENOMES := $(wildcard genomes/*.fna.gz)
# SPECIMENS, SPECIES, and the full dependency graph are generated by
# make_deps.py from the genome FASTA headers — like .d files in C.
# Make rebuilds deps.mk whenever genomes/ changes and restarts.
-include deps.mk
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
REF_DIST_CSVS := $(addprefix reference_dist/, \
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
euclidean_dist.csv relfreq_euclidean_dist.csv \
hellinger_dist.csv hellinger_euclidean_dist.csv)
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
hamming_dist.csv hamming_nj.nwk)
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
bray_curtis_dist.csv bray_curtis_nj.nwk \
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
euclidean_dist.csv euclidean_nj.nwk \
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
hellinger_dist.csv hellinger_nj.nwk \
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
DIST_COMPARISON := stats/dist_comparison/summary.csv
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
COUNT_STATS := $(SPECIMENS:%=stats/indexing_count/%.stats)
VERIFY_PRESENCE_STATS := $(SPECIMENS:%=stats/verify_presence/%.stats)
VERIFY_COUNT_STATS := $(SPECIMENS:%=stats/verify_count/%.stats)
SPECIFIC_PRESENCE_DONE := $(SPECIES:%=specific_index_presence/%/index.done)
SPECIFIC_PRESENCE_STATS := $(SPECIES:%=stats/specific_kmer_presence/%.stats)
SPECIFIC_COUNT_DONE := $(SPECIES:%=specific_index_count/%/index.done)
SPECIFIC_COUNT_STATS := $(SPECIES:%=stats/specific_kmer_count/%.stats)
SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/reads_R1.fastq.gz)
.NOTPARALLEL:
.PHONY: all simulate reference reference_dist \
obikmer_dist obikmer_dist_presence obikmer_dist_count \
dist_comparison \
index_presence index_count \
aggregate_index_presence aggregate_index_count \
merge_presence merge_count \
verify_presence verify_count \
aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
filter_presence filter_count \
aggregate_filter_presence aggregate_filter_count
verify_merge_presence: stats/verify_merge_presence/current.csv
verify_merge_count: stats/verify_merge_count/current.csv
all: aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
aggregate_filter_presence aggregate_filter_count \
dist_comparison
# ── dependency file ───────────────────────────────────────────────────────────
deps.mk: $(GENOMES)
$(VENV_PY) make_deps.py $^ > $@
# ── simulation ────────────────────────────────────────────────────────────────
# Prerequisites (genome → reads) are in deps.mk; $< is the genome file.
$(SIMULATED_READS):
bash simulate_one.sh $< $(dir $@)
simulate: $(SIMULATED_READS)
# ── reference kmer sets ───────────────────────────────────────────────────────
# Prerequisites (reads → npz) are in deps.mk.
reference_index/%.npz:
bash build_reference.sh $*
reference: $(REF_NPZS)
# ── reference distance matrices ───────────────────────────────────────────────
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
$(VENV_PY) build_reference_dist.py
reference_dist: $(REF_DIST_CSVS)
# ── obikmer distance (presence index) ────────────────────────────────────────
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
mkdir -p obikmer_dist/presence
$(BINARY) distance \
--output obikmer_dist/presence/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_presence
$(BINARY) distance \
--output obikmer_dist/presence/hamming \
--metric hamming --nj \
global_index_presence
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
# ── obikmer distance (count index) ───────────────────────────────────────────
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
mkdir -p obikmer_dist/count
$(BINARY) distance \
--output obikmer_dist/count/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/bray_curtis \
--metric bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_bray_curtis \
--metric relfreq-bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/euclidean \
--metric euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_euclidean \
--metric relfreq-euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger \
--metric hellinger --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger_euclidean \
--metric hellinger-euclidean --nj \
global_index_count
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
obikmer_dist: obikmer_dist_presence obikmer_dist_count
# ── distance comparison ───────────────────────────────────────────────────────
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
dist_comparison: $(DIST_COMPARISON)
# ── per-specimen indexing ─────────────────────────────────────────────────────
# Prerequisites (reads → index.done + .stats) are in deps.mk.
specimen_index_presence/%/index.done \
stats/indexing_presence/%.stats &: $(BINARY)
bash index_one_presence.sh $*
specimen_index_count/%/index.done \
stats/indexing_count/%.stats &: $(BINARY)
bash index_one_count.sh $*
index_presence: $(PRESENCE_DONE)
index_count: $(COUNT_DONE)
# ── indexing stats aggregation ────────────────────────────────────────────────
aggregate_index_presence: $(PRESENCE_STATS)
bash aggregate_stats.sh indexing_presence
aggregate_index_count: $(COUNT_STATS)
bash aggregate_stats.sh indexing_count
# ── global merge ──────────────────────────────────────────────────────────────
global_index_presence/index.done: $(PRESENCE_DONE) $(BINARY)
bash merge_presence.sh
global_index_count/index.done: $(COUNT_DONE) $(BINARY)
bash merge_count.sh
merge_presence: global_index_presence/index.done
merge_count: global_index_count/index.done
# ── per-specimen verification ─────────────────────────────────────────────────
# Prerequisites (index.done + npz → .stats) are in deps.mk.
stats/verify_presence/%.stats:
bash verify_one_presence.sh $*
stats/verify_count/%.stats:
bash verify_one_count.sh $*
verify_presence: $(VERIFY_PRESENCE_STATS)
verify_count: $(VERIFY_COUNT_STATS)
# ── verification stats aggregation ───────────────────────────────────────────
aggregate_verify_presence: $(VERIFY_PRESENCE_STATS)
bash aggregate_stats.sh verify_presence
aggregate_verify_count: $(VERIFY_COUNT_STATS)
bash aggregate_stats.sh verify_count
# ── species-specific indexes ──────────────────────────────────────────────────
# Prerequisites (global index → specific index) are in deps.mk.
specific_index_presence/%/index.done \
stats/specific_kmer_presence/%.stats &: $(BINARY)
bash filter_one_presence.sh $*
specific_index_count/%/index.done \
stats/specific_kmer_count/%.stats &: $(BINARY)
bash filter_one_count.sh $*
filter_presence: $(SPECIFIC_PRESENCE_DONE)
filter_count: $(SPECIFIC_COUNT_DONE)
aggregate_filter_presence: $(SPECIFIC_PRESENCE_STATS)
bash aggregate_stats.sh specific_kmer_presence
aggregate_filter_count: $(SPECIFIC_COUNT_STATS)
bash aggregate_stats.sh specific_kmer_count
# ── merged index verification ─────────────────────────────────────────────────
stats/verify_merge_presence/current.csv: $(REF_NPZS) global_index_presence/index.done
bash verify_merge_presence.sh
stats/verify_merge_count/current.csv: $(REF_NPZS) global_index_count/index.done
bash verify_merge_count.sh
+132
View File
@@ -0,0 +1,132 @@
# Benchmark pipeline
Requires **GNU Make ≥ 4.3** (grouped targets `&:`). On macOS use `gmake`.
```
gmake all # full pipeline
gmake simulate # simulation only
gmake reference # reference kmer sets only
```
## Pipeline overview
```mermaid
flowchart TD
GENOMES["genomes/*.fna.gz"]
BIN["obikmer binary"]
GENOMES --> simulate
simulate --> simdata[("simulated_data/")]
simdata --> reference
reference --> refnpz[("reference_index/*.npz")]
subgraph presence ["Presence track"]
simdata --> index_presence
BIN --> index_presence
index_presence --> pres_done[("specimen_index_presence/")]
index_presence --> pres_istats[("stats/indexing_presence/")]
pres_istats --> aggregate_index_presence
pres_done --> merge_presence
BIN --> merge_presence
merge_presence --> gpres[("global_index_presence/")]
refnpz --> verify_presence
pres_done --> verify_presence
verify_presence --> vpres_stats[("stats/verify_presence/")]
vpres_stats --> aggregate_verify_presence
gpres --> filter_presence
BIN --> filter_presence
filter_presence --> spec_pres[("specific_index_presence/")]
filter_presence --> spec_pres_stats[("stats/specific_kmer_presence/")]
spec_pres_stats --> aggregate_filter_presence
refnpz --> verify_merge_presence
gpres --> verify_merge_presence
verify_merge_presence --> vmp[("stats/verify_merge_presence/")]
end
subgraph count ["Count track"]
simdata --> index_count
BIN --> index_count
index_count --> count_done[("specimen_index_count/")]
index_count --> count_istats[("stats/indexing_count/")]
count_istats --> aggregate_index_count
count_done --> merge_count
BIN --> merge_count
merge_count --> gcount[("global_index_count/")]
refnpz --> verify_count
count_done --> verify_count
verify_count --> vcount_stats[("stats/verify_count/")]
vcount_stats --> aggregate_verify_count
gcount --> filter_count
BIN --> filter_count
filter_count --> spec_count[("specific_index_count/")]
filter_count --> spec_count_stats[("stats/specific_kmer_count/")]
spec_count_stats --> aggregate_filter_count
refnpz --> verify_merge_count
gcount --> verify_merge_count
verify_merge_count --> vmc[("stats/verify_merge_count/")]
end
aggregate_verify_presence --> all
aggregate_verify_count --> all
vmp --> all
vmc --> all
all -. "$(MAKE) re-eval" .-> aggregate_filter_presence
all -. "$(MAKE) re-eval" .-> aggregate_filter_count
```
## Steps
| Target | Script | Description |
|---|---|---|
| `simulate` | `simulate.sh` | Simulate sequencing reads from the reference genomes |
| `reference` | `build_reference.sh` | Build reference kmer sets (`.npz`) from simulation truth |
| `index_presence` | `index_one_presence.sh` | Index each specimen (presence mode) |
| `index_count` | `index_one_count.sh` | Index each specimen (count mode) |
| `aggregate_index_presence` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (presence) |
| `aggregate_index_count` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (count) |
| `merge_presence` | `merge_presence.sh` | Merge all specimen presence indexes into a global index |
| `merge_count` | `merge_count.sh` | Merge all specimen count indexes into a global index |
| `verify_presence` | `verify_one_presence.sh` | Verify each specimen presence index against reference |
| `verify_count` | `verify_one_count.sh` | Verify each specimen count index against reference |
| `aggregate_verify_presence` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (presence) |
| `aggregate_verify_count` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (count) |
| `filter_presence` | `filter_one_presence.sh` | Extract species-specific presence indexes from global index |
| `filter_count` | `filter_one_count.sh` | Extract species-specific count indexes from global index |
| `aggregate_filter_presence` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (presence) |
| `aggregate_filter_count` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (count) |
| `verify_merge_presence` | `verify_merge_presence.sh` | Verify global presence index against all reference sets |
| `verify_merge_count` | `verify_merge_count.sh` | Verify global count index against all reference sets |
## Directory layout
```
benchmark/
├── genomes/ # input reference genomes (.fna.gz)
├── simulated_data/ # generated by simulate
│ └── <species>/<specimen>/
├── reference_index/ # reference kmer sets (.npz)
├── specimen_index_presence/ # per-specimen presence indexes
├── specimen_index_count/ # per-specimen count indexes
├── global_index_presence/ # merged global presence index
├── global_index_count/ # merged global count index
├── specific_index_presence/ # species-specific presence indexes
├── specific_index_count/ # species-specific count indexes
└── stats/ # all benchmark statistics
├── indexing_presence/
├── indexing_count/
├── verify_presence/
├── verify_count/
├── specific_kmer_presence/
├── specific_kmer_count/
├── verify_merge_presence/
└── verify_merge_count/
```
+53
View File
@@ -0,0 +1,53 @@
#!/usr/bin/env bash
# Usage: aggregate_stats.sh TYPE
# TYPE = indexing_presence | indexing_count | verify_presence | verify_count
#
# Reads all stats/TYPE/*.stats files (one CSV data row each, no header).
# Creates a new stats/TYPE/run_NNN.csv only if any .stats file is newer than
# the most recent run CSV (idempotent when nothing changed).
set -euo pipefail
TYPE="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
STATS_DIR="${SCRIPT_DIR}/stats/${TYPE}"
case "${TYPE}" in
indexing_presence|indexing_count)
HEADER="run,species,strain,scatter_wall_s,scatter_rss_b,dereplicate_wall_s,dereplicate_rss_b,count_kmer_wall_s,count_kmer_rss_b,index_wall_s,index_rss_b,total_wall_s,total_rss_b"
;;
verify_presence)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct"
;;
verify_count)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,fn_pct,fp_pct,cm_pct"
;;
specific_kmer_presence|specific_kmer_count)
HEADER="run,species,rebuild_wall_s,rebuild_rss_b,pack_wall_s,pack_rss_b,filter_total_wall_s,filter_total_rss_b,select_wall_s,select_rss_b,select_total_wall_s,select_total_rss_b"
;;
*)
echo "ERROR: unknown stats type '${TYPE}'" >&2
exit 1
;;
esac
# Find most recent existing run CSV (empty string if none).
latest_csv=$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | sort | tail -1)
# Check if any .stats file is newer than the latest run CSV.
if [[ -n "${latest_csv}" ]] && \
[[ -z "$(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' -newer "${latest_csv}" 2>/dev/null)" ]]; then
echo "[${TYPE}] stats up to date (${latest_csv})"
exit 0
fi
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
echo "${HEADER}" >"${CSV}"
# Sort .stats files by name for reproducible row order.
while IFS= read -r stats_file; do
sed "s/^/${run_n},/" "${stats_file}"
done < <(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' | sort) >>"${CSV}"
echo "[${TYPE}] run ${run_n} → ${CSV}"
+137
View File
@@ -0,0 +1,137 @@
#!/usr/bin/env python3
"""Build a reference kmer index from paired-end FASTQ reads.
Extracts canonical kmers — min(kmer, revcomp(kmer)) encoded as uint64 —
counts their abundances, and saves a sorted numpy pair (kmers, counts).
Output .npz arrays
kmers : uint64, sorted ascending — canonical kmer integers
counts : uint32, same order — raw read abundances
"""
import argparse
import gzip
import sys
from collections import defaultdict
import numpy as np
# ── encoding ────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
# Lookup table: revcomp of one byte (4 bases, 8 bits).
# Precomputed once at import time.
_REVCOMP8 = [0] * 256
for _i in range(256):
_rc, _x = 0, _i
for _ in range(4):
_rc = (_rc << 2) | (3 - (_x & 3))
_x >>= 2
_REVCOMP8[_i] = _rc
del _i, _rc, _x
def revcomp_int(kmer: int, k: int) -> int:
"""Reverse-complement of a kmer encoded as an integer (2 bits/base).
Uses byte-level lookup (4 bases at a time) for speed.
"""
rc = 0
bits_left = 2 * k
while bits_left > 0:
chunk = min(8, bits_left)
rc_byte = _REVCOMP8[kmer & 0xFF] >> (8 - chunk)
rc = (rc << chunk) | rc_byte
kmer >>= chunk
bits_left -= chunk
return rc
# ── FASTQ parsing ────────────────────────────────────────────────────────────
def iter_sequences(path: str):
"""Yield raw sequences from a (gzipped) FASTQ file."""
opener = gzip.open if path.endswith('.gz') else open
with opener(path, 'rt') as fh:
while True:
if not fh.readline(): # '@' header
break
seq = fh.readline().rstrip('\n')
fh.readline() # '+'
fh.readline() # quality
yield seq
# ── kmer counting ────────────────────────────────────────────────────────────
def count_kmers(paths: list[str], k: int) -> dict[int, int]:
mask = (1 << (2 * k)) - 1
counts: dict[int, int] = defaultdict(int)
n_reads = 0
for path in paths:
for seq in iter_sequences(path):
n_reads += 1
kmer = 0
run = 0 # consecutive valid bases
for c in seq:
b = _ENCODE.get(c)
if b is None: # N or unexpected character → reset
kmer = 0
run = 0
continue
kmer = ((kmer << 2) | b) & mask
run += 1
if run >= k:
rc = revcomp_int(kmer, k)
counts[kmer if kmer <= rc else rc] += 1
if n_reads % 100_000 == 0:
print(f' {n_reads:,} reads processed, '
f'{len(counts):,} distinct kmers so far',
file=sys.stderr)
print(f' {n_reads:,} reads total, {len(counts):,} distinct kmers',
file=sys.stderr)
return counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reads', nargs='+', metavar='FASTQ',
help='Input reads (FASTQ, gzip OK)')
ap.add_argument('-k', '--kmer-size', type=int, default=31,
metavar='K')
ap.add_argument('--min-abundance', type=int, default=1,
metavar='N', help='Drop kmers with count < N (default 1)')
ap.add_argument('-o', '--output', required=True,
metavar='FILE', help='Output .npz path')
args = ap.parse_args()
print(f'k={args.kmer_size} files={len(args.reads)}', file=sys.stderr)
counts = count_kmers(args.reads, args.kmer_size)
if args.min_abundance > 1:
before = len(counts)
counts = {k: v for k, v in counts.items() if v >= args.min_abundance}
print(f' min-abundance={args.min_abundance}: '
f'{before - len(counts):,} kmers dropped, '
f'{len(counts):,} retained',
file=sys.stderr)
print(f'Sorting and saving → {args.output}', file=sys.stderr)
kmers_arr = np.fromiter(sorted(counts), dtype=np.uint64, count=len(counts))
counts_arr = np.array([counts[int(k)] for k in kmers_arr], dtype=np.uint32)
np.savez_compressed(args.output, kmers=kmers_arr, counts=counts_arr)
print(f'Done {len(kmers_arr):,} kmers → {args.output}', file=sys.stderr)
if __name__ == '__main__':
main()
+39
View File
@@ -0,0 +1,39 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
SIMDATA_DIR="${SCRIPT_DIR}/simulated_data"
REF_DIR="${SCRIPT_DIR}/reference_index"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
BUILD_PY="${SCRIPT_DIR}/build_reference.py"
KMER_SIZE="${KMER_SIZE:-31}"
MIN_ABUNDANCE="${MIN_ABUNDANCE:-1}"
mkdir -p "${REF_DIR}"
for species_dir in "${SIMDATA_DIR}"/*/; do
[[ -d "${species_dir}" ]] || continue
species=$(basename "${species_dir}")
for strain_dir in "${species_dir}"*/; do
[[ -d "${strain_dir}" ]] || continue
strain=$(basename "${strain_dir}")
r1="${strain_dir}/reads_R1.fastq.gz"
r2="${strain_dir}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "SKIP ${species}--${strain}: reads not found" >&2
continue
fi
out="${REF_DIR}/${species}--${strain}.npz"
echo "[${species}--${strain}] → ${out}"
"${PYTHON}" "${BUILD_PY}" \
--kmer-size "${KMER_SIZE}" \
--min-abundance "${MIN_ABUNDANCE}" \
--output "${out}" \
"${r1}" "${r2}"
done
done
+226
View File
@@ -0,0 +1,226 @@
#!/usr/bin/env python3
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
and writes one CSV per metric to reference_dist/.
Output CSV format matches `obikmer distance --output`:
- first row: "genome", then specimen names
- subsequent rows: specimen name, then float or int values
Metrics written
jaccard_dist.csv Jaccard distance (presence/absence)
shared_kmers.csv Shared-kmer count matrix (intersection size)
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
euclidean_dist.csv Euclidean distance (raw counts)
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
hellinger_dist.csv Hellinger distance
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
"""
import argparse
import sys
from pathlib import Path
import numpy as np
# ── pairwise helpers ──────────────────────────────────────────────────────────
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
"""
pos = np.searchsorted(a_kmers, b_kmers)
pos = np.clip(pos, 0, len(a_kmers) - 1)
mask = a_kmers[pos] == b_kmers
idx_b = np.where(mask)[0]
idx_a = pos[idx_b]
return idx_a, idx_b
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
"""Compute all pairwise distance matrices at once.
Returns a dict metric_name → ndarray (n×n float64 or int64).
Each specimen dict has keys: name, kmers, counts.
"""
n = len(specimens)
# Pre-compute per-specimen scalars
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
# Per-specimen sum-of-squares (for Euclidean decomposition)
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
# Allocate output matrices
shared_mat = np.zeros((n, n), dtype=np.uint64)
hamming_mat = np.zeros((n, n), dtype=np.float64)
jaccard_mat = np.zeros((n, n), dtype=np.float64)
bray_mat = np.zeros((n, n), dtype=np.float64)
relfreq_bray = np.zeros((n, n), dtype=np.float64)
euclidean_mat = np.zeros((n, n), dtype=np.float64)
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
hellinger_mat = np.zeros((n, n), dtype=np.float64)
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
for i in range(n):
a_km = specimens[i]['kmers']
a_ct = specimens[i]['counts'].astype(np.float64)
sa = float(count_sums[i])
na = int(kmer_counts[i])
for j in range(i + 1, n):
b_km = specimens[j]['kmers']
b_ct = specimens[j]['counts'].astype(np.float64)
sb = float(count_sums[j])
nb = int(kmer_counts[j])
idx_a, idx_b = shared_indices(a_km, b_km)
inter = len(idx_a)
ca_sh = a_ct[idx_a]
cb_sh = b_ct[idx_b]
# ── Presence metrics ──────────────────────────────────────────────
union = na + nb - inter
jac = (1.0 - inter / union) if union else 0.0
hamming = float(na + nb - 2 * inter) # |A Δ B|
# ── Count metrics ─────────────────────────────────────────────────
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
sum_min = np.minimum(ca_sh, cb_sh).sum()
denom_bc = sa + sb
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
if sa and sb:
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
else:
rfb = 0.0
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
cross = (ca_sh * cb_sh).sum()
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
eucl = np.sqrt(max(eucl_partial, 0.0))
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
if sa and sb:
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
rfe_partial = (sq_sums[i] / sa**2
+ sq_sums[j] / sb**2
- 2.0 * rf_cross)
rfe = np.sqrt(max(rfe_partial, 0.0))
else:
rfe = 0.0
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
if sa and sb:
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
else:
hell_partial = 0.0
sq2 = np.sqrt(2.0)
hell = np.sqrt(hell_partial) / sq2
hell_euc = np.sqrt(hell_partial)
# ── Fill symmetric matrices ───────────────────────────────────────
for mat, val in [
(shared_mat, inter),
(hamming_mat, hamming),
(jaccard_mat, jac),
(bray_mat, bc),
(relfreq_bray, rfb),
(euclidean_mat, eucl),
(relfreq_eucl, rfe),
(hellinger_mat, hell),
(hell_eucl_mat, hell_euc),
]:
mat[i, j] = val
mat[j, i] = val
return {
'shared_kmers': shared_mat,
'hamming_dist': hamming_mat,
'jaccard_dist': jaccard_mat,
'bray_curtis_dist': bray_mat,
'relfreq_bray_curtis_dist': relfreq_bray,
'euclidean_dist': euclidean_mat,
'relfreq_euclidean_dist': relfreq_eucl,
'hellinger_dist': hellinger_mat,
'hellinger_euclidean_dist': hell_eucl_mat,
}
# ── I/O ───────────────────────────────────────────────────────────────────────
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
with path.open('w') as fh:
fh.write('genome,' + ','.join(labels) + '\n')
for i, label in enumerate(labels):
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
fh.write(f'{label},{row}\n')
print(f' → {path}', file=sys.stderr)
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--ref-dir', default='reference_index',
help='Directory with per-specimen .npz files (default: reference_index)')
ap.add_argument('--out-dir', default='reference_dist',
help='Output directory for CSV files (default: reference_dist)')
args = ap.parse_args()
ref_dir = Path(args.ref_dir)
out_dir = Path(args.out_dir)
out_dir.mkdir(exist_ok=True)
npz_files = sorted(ref_dir.glob('*.npz'))
if not npz_files:
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
sys.exit(1)
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
specimens = []
for f in npz_files:
data = np.load(f)
specimens.append({
'name': f.stem,
'kmers': data['kmers'],
'counts': data['counts'],
})
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
labels = [s['name'] for s in specimens]
n = len(labels)
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
matrices = pairwise_stats(specimens)
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
print('\nDone.', file=sys.stderr)
if __name__ == '__main__':
main()
+182
View File
@@ -0,0 +1,182 @@
#!/usr/bin/env python3
"""Compare all reference distance matrices against obikmer distance outputs.
Reads from:
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
obikmer_dist/ — matrices produced by `obikmer distance`
Handles label reordering: both matrices are sorted by genome label before
element-wise comparison, so column/row order differences are irrelevant.
Output: stats/dist_comparison/summary.csv
comparison,max_abs,mean_abs,rmse,n_pairs,status
"""
import csv
import sys
from pathlib import Path
import numpy as np
# ── CSV loading ───────────────────────────────────────────────────────────────
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
with path.open() as fh:
reader = csv.reader(fh)
header = next(reader)[1:] # skip 'genome' column
raw: dict[str, list[float]] = {}
for row in reader:
raw[row[0]] = [float(x) for x in row[1:]]
label_to_col = {h: i for i, h in enumerate(header)}
labels = sorted(raw.keys())
n = len(labels)
mat = np.zeros((n, n), dtype=np.float64)
for i, ri in enumerate(labels):
for j, cj in enumerate(labels):
mat[i, j] = raw[ri][label_to_col[cj]]
return labels, mat
# ── comparison ────────────────────────────────────────────────────────────────
def compare(label: str,
ref_path: Path,
obi_path: Path,
tol: float = 1e-4) -> dict:
if not ref_path.exists():
return {'comparison': label, 'status': 'REF_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
if not obi_path.exists():
return {'comparison': label, 'status': 'OBI_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
ref_labels, ref_mat = load_matrix(ref_path)
obi_labels, obi_mat = load_matrix(obi_path)
if ref_labels != obi_labels:
only_ref = sorted(set(ref_labels) - set(obi_labels))
only_obi = sorted(set(obi_labels) - set(ref_labels))
print(f' [{label}] label mismatch — '
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
return {'comparison': label, 'status': 'LABEL_MISMATCH',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
n = len(ref_labels)
# Off-diagonal mask
mask = ~np.eye(n, dtype=bool)
diff = np.abs(ref_mat[mask] - obi_mat[mask])
n_pairs = diff.size
max_abs = float(diff.max())
mean_abs = float(diff.mean())
rmse = float(np.sqrt((diff ** 2).mean()))
status = 'PASS' if max_abs <= tol else 'FAIL'
print(f' [{label}] n={n_pairs} '
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
file=sys.stderr)
return {
'comparison': label,
'max_abs': f'{max_abs:.6e}',
'mean_abs': f'{mean_abs:.6e}',
'rmse': f'{rmse:.6e}',
'n_pairs': str(n_pairs),
'status': status,
}
# ── comparison table ──────────────────────────────────────────────────────────
# (label, ref_csv, obikmer_csv)
# The reference jaccard/shared is presence-based, which should match both
# presence/jaccard and count/jaccard (threshold=1).
COMPARISONS = [
# ── presence index ────────────────────────────────────────────────────────
('presence/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/presence/jaccard_dist.csv'),
('presence/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/presence/jaccard_shared.csv'),
('presence/hamming_dist',
'reference_dist/hamming_dist.csv',
'obikmer_dist/presence/hamming_dist.csv'),
# ── count index (jaccard cross-check) ─────────────────────────────────────
('count/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/count/jaccard_dist.csv'),
('count/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/count/jaccard_shared.csv'),
# ── count index (count-based metrics) ────────────────────────────────────
('count/bray_curtis_dist',
'reference_dist/bray_curtis_dist.csv',
'obikmer_dist/count/bray_curtis_dist.csv'),
('count/relfreq_bray_curtis_dist',
'reference_dist/relfreq_bray_curtis_dist.csv',
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
('count/euclidean_dist',
'reference_dist/euclidean_dist.csv',
'obikmer_dist/count/euclidean_dist.csv'),
('count/relfreq_euclidean_dist',
'reference_dist/relfreq_euclidean_dist.csv',
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
('count/hellinger_dist',
'reference_dist/hellinger_dist.csv',
'obikmer_dist/count/hellinger_dist.csv'),
('count/hellinger_euclidean_dist',
'reference_dist/hellinger_euclidean_dist.csv',
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
]
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
import argparse
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--tol', type=float, default=1e-4,
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
help='Output summary CSV path')
args = ap.parse_args()
out_path = Path(args.out)
out_path.parent.mkdir(parents=True, exist_ok=True)
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
rows = []
for label, ref, obi in COMPARISONS:
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
with out_path.open('w', newline='') as fh:
w = csv.DictWriter(fh, fieldnames=fields)
w.writeheader()
w.writerows(rows)
print(f'\n→ {out_path}', file=sys.stderr)
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
if n_fail:
sys.exit(1)
if __name__ == '__main__':
main()
+199
View File
@@ -0,0 +1,199 @@
SPECIMENS := Escherichia_coli--K-12_MG1655 Escherichia_coli--EDL933 Salmonella_enterica--LT2 Escherichia_coli--CFT073 Bacillus_subtilis--168 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Saccharolobus_islandicus--M.16.4 Acidobacterium_capsulatum--ATCC_51196 Salmonella_enterica--AKU_12601 Proteus_mirabilis--HI4320 Salmonella_enterica--CT18 Klebsiella_pneumoniae--HS11286 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Klebsiella_pneumoniae--ATCC_13883 Yersinia_ruckeri--YRB Candidozyma_auris--GCF_003013715.1_ASM301371v2
SPECIES := Escherichia_coli Salmonella_enterica Bacillus_subtilis Shouchella_clausii Klebsiella_pneumoniae Opitutus_terrae Saccharolobus_islandicus Acidobacterium_capsulatum Proteus_mirabilis Wolbachia_endosymbiont Yersinia_ruckeri Candidozyma_auris
# Escherichia_coli--K-12_MG1655
simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz: genomes/GCF_000005845.2_ASM584v2_genomic.fna.gz
reference_index/Escherichia_coli--K-12_MG1655.npz: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done stats/indexing_presence/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_MG1655/index.done stats/indexing_count/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done
stats/verify_count/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_count/Escherichia_coli--K-12_MG1655/index.done
# Escherichia_coli--EDL933
simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz: genomes/GCF_000006665.1_ASM666v1_genomic.fna.gz
reference_index/Escherichia_coli--EDL933.npz: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--EDL933/index.done stats/indexing_presence/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--EDL933/index.done stats/indexing_count/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_presence/Escherichia_coli--EDL933/index.done
stats/verify_count/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_count/Escherichia_coli--EDL933/index.done
# Salmonella_enterica--LT2
simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz: genomes/GCF_000006945.2_ASM694v2_genomic.fna.gz
reference_index/Salmonella_enterica--LT2.npz: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--LT2/index.done stats/indexing_presence/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--LT2/index.done stats/indexing_count/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_presence/Salmonella_enterica--LT2/index.done
stats/verify_count/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_count/Salmonella_enterica--LT2/index.done
# Escherichia_coli--CFT073
simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz: genomes/GCF_000007445.1_ASM744v1_genomic.fna.gz
reference_index/Escherichia_coli--CFT073.npz: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--CFT073/index.done stats/indexing_presence/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--CFT073/index.done stats/indexing_count/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_presence/Escherichia_coli--CFT073/index.done
stats/verify_count/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_count/Escherichia_coli--CFT073/index.done
# Bacillus_subtilis--168
simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz: genomes/GCF_000009045.1_ASM904v1_genomic.fna.gz
reference_index/Bacillus_subtilis--168.npz: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_presence/Bacillus_subtilis--168/index.done stats/indexing_presence/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_count/Bacillus_subtilis--168/index.done stats/indexing_count/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
stats/verify_presence/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_presence/Bacillus_subtilis--168/index.done
stats/verify_count/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_count/Bacillus_subtilis--168/index.done
# Salmonella_enterica--P125109
simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz: genomes/GCF_000009505.1_ASM950v1_genomic.fna.gz
reference_index/Salmonella_enterica--P125109.npz: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--P125109/index.done stats/indexing_presence/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--P125109/index.done stats/indexing_count/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_presence/Salmonella_enterica--P125109/index.done
stats/verify_count/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_count/Salmonella_enterica--P125109/index.done
# Shouchella_clausii--KSM-K16
simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz: genomes/GCF_000009825.1_ASM982v1_genomic.fna.gz
reference_index/Shouchella_clausii--KSM-K16.npz: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_presence/Shouchella_clausii--KSM-K16/index.done stats/indexing_presence/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_count/Shouchella_clausii--KSM-K16/index.done stats/indexing_count/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
stats/verify_presence/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_presence/Shouchella_clausii--KSM-K16/index.done
stats/verify_count/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_count/Shouchella_clausii--KSM-K16/index.done
# Escherichia_coli--K-12_W3110
simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz: genomes/GCF_000010245.2_ASM1024v1_genomic.fna.gz
reference_index/Escherichia_coli--K-12_W3110.npz: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_W3110/index.done stats/indexing_presence/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_W3110/index.done stats/indexing_count/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_presence/Escherichia_coli--K-12_W3110/index.done
stats/verify_count/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_count/Escherichia_coli--K-12_W3110/index.done
# Klebsiella_pneumoniae--MGH_78578
simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz: genomes/GCF_000016305.1_ASM1630v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--MGH_78578.npz: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_presence/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_count/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done
stats/verify_count/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done
# Opitutus_terrae--PB90-1
simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz: genomes/GCF_000019965.1_ASM1996v1_genomic.fna.gz
reference_index/Opitutus_terrae--PB90-1.npz: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_presence/Opitutus_terrae--PB90-1/index.done stats/indexing_presence/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_count/Opitutus_terrae--PB90-1/index.done stats/indexing_count/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
stats/verify_presence/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_presence/Opitutus_terrae--PB90-1/index.done
stats/verify_count/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_count/Opitutus_terrae--PB90-1/index.done
# Saccharolobus_islandicus--M.16.4
simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz: genomes/GCF_000022445.1_ASM2244v1_genomic.fna.gz
reference_index/Saccharolobus_islandicus--M.16.4.npz: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_presence/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_count/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
stats/verify_presence/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done
stats/verify_count/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done
# Acidobacterium_capsulatum--ATCC_51196
simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz: genomes/GCF_000022565.1_ASM2256v1_genomic.fna.gz
reference_index/Acidobacterium_capsulatum--ATCC_51196.npz: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_presence/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_count/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
stats/verify_presence/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done
stats/verify_count/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done
# Salmonella_enterica--AKU_12601
simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz: genomes/GCF_000026565.1_ASM2656v1_genomic.fna.gz
reference_index/Salmonella_enterica--AKU_12601.npz: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--AKU_12601/index.done stats/indexing_presence/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--AKU_12601/index.done stats/indexing_count/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_presence/Salmonella_enterica--AKU_12601/index.done
stats/verify_count/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_count/Salmonella_enterica--AKU_12601/index.done
# Proteus_mirabilis--HI4320
simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz: genomes/GCF_000069965.1_ASM6996v1_genomic.fna.gz
reference_index/Proteus_mirabilis--HI4320.npz: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_presence/Proteus_mirabilis--HI4320/index.done stats/indexing_presence/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_count/Proteus_mirabilis--HI4320/index.done stats/indexing_count/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
stats/verify_presence/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_presence/Proteus_mirabilis--HI4320/index.done
stats/verify_count/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_count/Proteus_mirabilis--HI4320/index.done
# Salmonella_enterica--CT18
simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz: genomes/GCF_000195995.1_ASM19599v1_genomic.fna.gz
reference_index/Salmonella_enterica--CT18.npz: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--CT18/index.done stats/indexing_presence/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--CT18/index.done stats/indexing_count/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_presence/Salmonella_enterica--CT18/index.done
stats/verify_count/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_count/Salmonella_enterica--CT18/index.done
# Klebsiella_pneumoniae--HS11286
simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz: genomes/GCF_000240185.1_ASM24018v2_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--HS11286.npz: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_presence/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_count/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done
stats/verify_count/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done
# Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1
simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz: genomes/GCF_000306885.1_ASM30688v1_genomic.fna.gz
reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
stats/verify_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
stats/verify_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
# Klebsiella_pneumoniae--ATCC_13883
simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz: genomes/GCF_000742135.1_ASM74213v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--ATCC_13883.npz: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_presence/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_count/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done
stats/verify_count/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done
# Yersinia_ruckeri--YRB
simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz: genomes/GCF_000834255.1_ASM83425v1_genomic.fna.gz
reference_index/Yersinia_ruckeri--YRB.npz: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_presence/Yersinia_ruckeri--YRB/index.done stats/indexing_presence/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_count/Yersinia_ruckeri--YRB/index.done stats/indexing_count/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
stats/verify_presence/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_presence/Yersinia_ruckeri--YRB/index.done
stats/verify_count/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_count/Yersinia_ruckeri--YRB/index.done
# Candidozyma_auris--GCF_003013715.1_ASM301371v2
simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz: genomes/GCF_003013715.1_ASM301371v2_genomic.fna.gz
reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
stats/verify_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
stats/verify_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
# Escherichia_coli
specific_index_presence/Escherichia_coli/index.done stats/specific_kmer_presence/Escherichia_coli.stats: global_index_presence/index.done
specific_index_count/Escherichia_coli/index.done stats/specific_kmer_count/Escherichia_coli.stats: global_index_count/index.done
# Salmonella_enterica
specific_index_presence/Salmonella_enterica/index.done stats/specific_kmer_presence/Salmonella_enterica.stats: global_index_presence/index.done
specific_index_count/Salmonella_enterica/index.done stats/specific_kmer_count/Salmonella_enterica.stats: global_index_count/index.done
# Bacillus_subtilis
specific_index_presence/Bacillus_subtilis/index.done stats/specific_kmer_presence/Bacillus_subtilis.stats: global_index_presence/index.done
specific_index_count/Bacillus_subtilis/index.done stats/specific_kmer_count/Bacillus_subtilis.stats: global_index_count/index.done
# Shouchella_clausii
specific_index_presence/Shouchella_clausii/index.done stats/specific_kmer_presence/Shouchella_clausii.stats: global_index_presence/index.done
specific_index_count/Shouchella_clausii/index.done stats/specific_kmer_count/Shouchella_clausii.stats: global_index_count/index.done
# Klebsiella_pneumoniae
specific_index_presence/Klebsiella_pneumoniae/index.done stats/specific_kmer_presence/Klebsiella_pneumoniae.stats: global_index_presence/index.done
specific_index_count/Klebsiella_pneumoniae/index.done stats/specific_kmer_count/Klebsiella_pneumoniae.stats: global_index_count/index.done
# Opitutus_terrae
specific_index_presence/Opitutus_terrae/index.done stats/specific_kmer_presence/Opitutus_terrae.stats: global_index_presence/index.done
specific_index_count/Opitutus_terrae/index.done stats/specific_kmer_count/Opitutus_terrae.stats: global_index_count/index.done
# Saccharolobus_islandicus
specific_index_presence/Saccharolobus_islandicus/index.done stats/specific_kmer_presence/Saccharolobus_islandicus.stats: global_index_presence/index.done
specific_index_count/Saccharolobus_islandicus/index.done stats/specific_kmer_count/Saccharolobus_islandicus.stats: global_index_count/index.done
# Acidobacterium_capsulatum
specific_index_presence/Acidobacterium_capsulatum/index.done stats/specific_kmer_presence/Acidobacterium_capsulatum.stats: global_index_presence/index.done
specific_index_count/Acidobacterium_capsulatum/index.done stats/specific_kmer_count/Acidobacterium_capsulatum.stats: global_index_count/index.done
# Proteus_mirabilis
specific_index_presence/Proteus_mirabilis/index.done stats/specific_kmer_presence/Proteus_mirabilis.stats: global_index_presence/index.done
specific_index_count/Proteus_mirabilis/index.done stats/specific_kmer_count/Proteus_mirabilis.stats: global_index_count/index.done
# Wolbachia_endosymbiont
specific_index_presence/Wolbachia_endosymbiont/index.done stats/specific_kmer_presence/Wolbachia_endosymbiont.stats: global_index_presence/index.done
specific_index_count/Wolbachia_endosymbiont/index.done stats/specific_kmer_count/Wolbachia_endosymbiont.stats: global_index_count/index.done
# Yersinia_ruckeri
specific_index_presence/Yersinia_ruckeri/index.done stats/specific_kmer_presence/Yersinia_ruckeri.stats: global_index_presence/index.done
specific_index_count/Yersinia_ruckeri/index.done stats/specific_kmer_count/Yersinia_ruckeri.stats: global_index_count/index.done
# Candidozyma_auris
specific_index_presence/Candidozyma_auris/index.done stats/specific_kmer_presence/Candidozyma_auris.stats: global_index_presence/index.done
specific_index_count/Candidozyma_auris/index.done stats/specific_kmer_count/Candidozyma_auris.stats: global_index_count/index.done
+48
View File
@@ -0,0 +1,48 @@
#!/usr/bin/env bash
set -euo pipefail
assemblies=(
GCF_000005845.2
GCF_000010245.2
GCF_000007445.1
GCF_000006665.1
GCF_000006945.2
GCF_000195995.1
GCF_000009505.1
GCF_000026565.1
GCF_000016305.1
GCF_000019965.1
GCF_000240185.1
GCF_000742135.1
GCF_000069965.1
GCF_000022565.1
GCF_000306885.1
GCF_003013715.1
GCF_000009045.1
GCF_000009825.1
GCF_000022445.1
GCF_000834255.1
)
mkdir -p genomes
for acc in "${assemblies[@]}"; do
echo "Downloading ${acc}"
datasets download genome accession "${acc}" \
--include genome \
--filename "${acc}.zip"
unzip -q "${acc}.zip" -d "${acc}"
find "${acc}" -name "*.fna" |
while read file; do
obiconvert -Z ${file} >genomes/$(basename ${file}).gz
done
rm -rf "${acc}" "${acc}.zip"
done
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_count.sh SPECIES
# Filters global_index_count to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_count/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_count/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_count"
OUTPUT="${SCRIPT_DIR}/specific_index_count/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_count"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (count) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_presence.sh SPECIES
# Filters global_index_presence to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_presence/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_presence/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_presence"
OUTPUT="${SCRIPT_DIR}/specific_index_presence/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_presence"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (presence) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
# Usage: index_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_count/SPECIMEN/index.done (written by obikmer)
# stats/indexing_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (count) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--with-counts \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+102
View File
@@ -0,0 +1,102 @@
#!/usr/bin/env bash
# Usage: index_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_presence/SPECIMEN/index.done (written by obikmer)
# stats/indexing_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (presence) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+118
View File
@@ -0,0 +1,118 @@
#!/usr/bin/env python3
"""Generate deps.mk — pure dependency declarations for the benchmark pipeline.
Like C .d files: only target: prerequisites lines, no recipes.
Recipes stay in the Makefile as generic rules.
"""
import gzip
import re
import sys
from pathlib import Path
STOP_WORDS = {'complete', 'chromosome', 'whole', 'sequence', 'genome',
'endosymbiont', 'of'}
STOP_PREFIXES = ('scaffold', 'contig', 'plasmid')
def is_stop(tok):
t = tok.lower()
return t in STOP_WORDS or any(t.startswith(p) for p in STOP_PREFIXES)
def sanitize(s):
return re.sub(r'[^A-Za-z0-9._-]', '_', s).strip('_')
def collect_tokens(text):
parts = []
for tok in text.split():
tok = tok.rstrip(',.')
if is_stop(tok):
break
parts.append(sanitize(tok))
return '_'.join(filter(None, parts))
def parse_organism(defn, gcf_id):
words = defn.split()
species = sanitize(words[0] + '_' + words[1])
m = re.search(r'\bstr\.\s+(\S+)(?:\s+substr\.\s+(\S+))?', defn)
if m:
strain = sanitize(m.group(1))
if m.group(2):
strain += '_' + sanitize(m.group(2))
return species, strain
m = re.search(r'\bstrain\b\s+(.*)', defn)
if m:
strain = collect_tokens(m.group(1))
if strain:
return species, strain
remainder = re.sub(r'^\S+ \S+\s*', '', defn)
remainder = re.sub(r'^subsp\.\s+\S+\s*', '', remainder)
remainder = re.sub(r'^serovar\s+\S+\s*', '', remainder)
strain = collect_tokens(remainder)
return species, strain if strain else gcf_id
def first_definition(path):
with gzip.open(path, 'rt') as fh:
for line in fh:
if line.startswith('>'):
m = re.search(r'"definition":"([^"]*)"', line)
return m.group(1) if m else line[1:].split()[0]
return Path(path).stem
def main():
entries = [] # (specimen, species, sim_dir, genome_path)
species_seen = []
for path in sorted(sys.argv[1:]):
gcf_id = Path(path).name.replace('_genomic.fna.gz', '')
defn = first_definition(path)
sp, st = parse_organism(defn, gcf_id)
specimen = f'{sp}--{st}'
sim_dir = f'simulated_data/{sp}/{st}'
entries.append((specimen, sp, sim_dir, path))
if sp not in species_seen:
species_seen.append(sp)
specimens = [e[0] for e in entries]
print('SPECIMENS :=', ' '.join(specimens))
print('SPECIES :=', ' '.join(species_seen))
for specimen, species, sim_dir, genome in entries:
reads = f'{sim_dir}/reads_R1.fastq.gz'
p_done = f'specimen_index_presence/{specimen}/index.done'
p_stats = f'stats/indexing_presence/{specimen}.stats'
c_done = f'specimen_index_count/{specimen}/index.done'
c_stats = f'stats/indexing_count/{specimen}.stats'
ref = f'reference_index/{specimen}.npz'
vp = f'stats/verify_presence/{specimen}.stats'
vc = f'stats/verify_count/{specimen}.stats'
print()
print(f'# {specimen}')
print(f'{reads}: {genome}')
print(f'{ref}: {reads}')
print(f'{p_done} {p_stats}: {reads}')
print(f'{c_done} {c_stats}: {reads}')
print(f'{vp}: {ref} {p_done}')
print(f'{vc}: {ref} {c_done}')
print()
for sp in species_seen:
sp_done = f'specific_index_presence/{sp}/index.done'
sp_stats = f'stats/specific_kmer_presence/{sp}.stats'
sc_done = f'specific_index_count/{sp}/index.done'
sc_stats = f'stats/specific_kmer_count/{sp}.stats'
print(f'# {sp}')
print(f'{sp_done} {sp_stats}: global_index_presence/index.done')
print(f'{sc_done} {sc_stats}: global_index_count/index.done')
if __name__ == '__main__':
main()
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_count"
OUTPUT="${SCRIPT_DIR}/global_index_count"
STATS_DIR="${SCRIPT_DIR}/stats/merge_count"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} count indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n} → ${CSV}"
+104
View File
@@ -0,0 +1,104 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_presence"
OUTPUT="${SCRIPT_DIR}/global_index_presence"
STATS_DIR="${SCRIPT_DIR}/stats/merge_presence"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} presence indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
--force-presence \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n} → ${CSV}"
+12
View File
@@ -0,0 +1,12 @@
#!/usr/bin/env bash
# Simulate all genomes. Delegates to simulate_one.sh per genome.
# Prefer running via `gmake simulate` which handles individual dependencies.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
for genome_file in "${SCRIPT_DIR}"/genomes/*.fna.gz; do
out_dir=$("${SCRIPT_DIR}/../.venv/bin/python3" "${SCRIPT_DIR}/make_deps.py" \
--dir-for "${genome_file}")
bash "${SCRIPT_DIR}/simulate_one.sh" "${genome_file}" "${out_dir}"
done
+33
View File
@@ -0,0 +1,33 @@
#!/usr/bin/env bash
# Usage: simulate_one.sh genome.fna.gz output_dir
# Simulates paired-end HiSeq reads for a single genome.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
ISS="${SCRIPT_DIR}/../.venv/bin/iss"
COVERAGE=15
READ_LENGTH=150
CPUS="${CPUS:-$(sysctl -n hw.logicalcpu 2>/dev/null || nproc 2>/dev/null || echo 2)}"
genome_file="$1"
out_dir="$2"
mkdir -p "${out_dir}"
tmp_fasta=$(mktemp "${TMPDIR:-/tmp}/obikmer_XXXXXX.fna")
trap 'rm -f "${tmp_fasta}"' EXIT
gzip -dc "${genome_file}" > "${tmp_fasta}"
genome_size=$(grep -v "^>" "${tmp_fasta}" | tr -d '[:space:]' | wc -c | tr -d ' ')
n_reads=$(python3 -c "import math; print(math.ceil(${COVERAGE} * ${genome_size} / (2 * ${READ_LENGTH})))")
echo "[${out_dir}] genome=${genome_size} bp → ${n_reads} read pairs (${COVERAGE}x HiSeq)"
"${ISS}" generate \
--genomes "${tmp_fasta}" \
--model HiSeq \
--n_reads "${n_reads}" \
--cpus "${CPUS}" \
--compress \
--output "${out_dir}/reads"
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
3 Acidobacterium_capsulatum--ATCC_51196 1.000000 0.000000 0.999981 0.999990 0.999989 0.999987 0.999987 0.999990 0.999988 0.999988 0.999994 0.999989 1.000000 0.999988 0.999987 0.999987 0.999988 0.999989 0.999991 0.999987
4 Bacillus_subtilis--168 1.000000 0.999981 0.000000 0.999990 0.999989 0.999989 0.999989 0.999989 0.999988 0.999986 0.999995 0.999985 0.999999 0.999988 0.999987 0.999989 0.999988 0.999778 0.999993 0.999987
5 Escherichia_coli--CFT073 1.000000 0.999990 0.999990 0.000000 0.825741 0.807495 0.807218 0.991156 0.996855 0.997849 0.999996 0.999633 1.000000 0.993885 0.996736 0.994148 0.993821 0.999991 0.999984 0.999291
6 Escherichia_coli--EDL933 1.000000 0.999989 0.999989 0.825741 0.000000 0.735107 0.734775 0.996126 0.998058 0.997908 0.999997 0.999640 1.000000 0.993993 0.997126 0.994390 0.994059 0.999991 0.999986 0.999292
7 Escherichia_coli--K-12_MG1655 1.000000 0.999987 0.999989 0.807495 0.735107 0.000000 0.382567 0.996190 0.997747 0.997455 0.999996 0.999604 1.000000 0.993444 0.996645 0.993773 0.993431 0.999989 0.999984 0.999174
8 Escherichia_coli--K-12_W3110 1.000000 0.999987 0.999989 0.807218 0.734775 0.382567 0.000000 0.996220 0.997761 0.997467 0.999995 0.999604 1.000000 0.993445 0.996669 0.993769 0.993443 0.999990 0.999985 0.999165
9 Klebsiella_pneumoniae--ATCC_13883 1.000000 0.999990 0.999989 0.991156 0.996126 0.996190 0.996220 0.000000 0.845220 0.840545 0.999997 0.999648 1.000000 0.996177 0.998128 0.996268 0.996052 0.999990 0.999987 0.999325
10 Klebsiella_pneumoniae--HS11286 1.000000 0.999988 0.999988 0.996855 0.998058 0.997747 0.997761 0.845220 0.000000 0.906475 0.999996 0.999683 1.000000 0.997724 0.995697 0.997776 0.997769 0.999989 0.999979 0.999463
11 Klebsiella_pneumoniae--MGH_78578 1.000000 0.999988 0.999986 0.997849 0.997908 0.997455 0.997467 0.840545 0.906475 0.000000 0.999996 0.999704 1.000000 0.997928 0.995054 0.997844 0.997868 0.999990 0.999980 0.999479
12 Opitutus_terrae--PB90-1 1.000000 0.999994 0.999995 0.999996 0.999997 0.999996 0.999995 0.999997 0.999996 0.999996 0.000000 0.999997 0.999998 0.999996 0.999996 0.999996 0.999995 0.999997 0.999993 0.999996
13 Proteus_mirabilis--HI4320 1.000000 0.999989 0.999985 0.999633 0.999640 0.999604 0.999604 0.999648 0.999683 0.999704 0.999997 0.000000 1.000000 0.999604 0.999699 0.999622 0.999613 0.999987 0.999983 0.999505
14 Saccharolobus_islandicus--M.16.4 1.000000 1.000000 0.999999 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 0.999998 1.000000 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
15 Salmonella_enterica--AKU_12601 1.000000 0.999988 0.999988 0.993885 0.993993 0.993444 0.993445 0.996177 0.997724 0.997928 0.999996 0.999604 1.000000 0.000000 0.869238 0.682277 0.663383 0.999990 0.999985 0.999260
16 Salmonella_enterica--CT18 1.000000 0.999987 0.999987 0.996736 0.997126 0.996645 0.996669 0.998128 0.995697 0.995054 0.999996 0.999699 1.000000 0.869238 0.000000 0.890872 0.886148 0.999988 0.999976 0.999524
17 Salmonella_enterica--LT2 1.000000 0.999987 0.999989 0.994148 0.994390 0.993773 0.993769 0.996268 0.997776 0.997844 0.999996 0.999622 1.000000 0.682277 0.890872 0.000000 0.622606 0.999989 0.999985 0.999296
18 Salmonella_enterica--P125109 1.000000 0.999988 0.999988 0.993821 0.994059 0.993431 0.993443 0.996052 0.997769 0.997868 0.999995 0.999613 1.000000 0.663383 0.886148 0.622606 0.000000 0.999988 0.999983 0.999270
19 Shouchella_clausii--KSM-K16 1.000000 0.999989 0.999778 0.999991 0.999991 0.999989 0.999990 0.999990 0.999989 0.999990 0.999997 0.999987 1.000000 0.999990 0.999988 0.999989 0.999988 0.000000 0.999991 0.999988
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 1.000000 0.999991 0.999993 0.999984 0.999986 0.999984 0.999985 0.999987 0.999979 0.999980 0.999993 0.999983 1.000000 0.999985 0.999976 0.999985 0.999983 0.999991 0.000000 0.999983
21 Yersinia_ruckeri--YRB 1.000000 0.999987 0.999987 0.999291 0.999292 0.999174 0.999165 0.999325 0.999463 0.999479 0.999996 0.999505 1.000000 0.999260 0.999524 0.999296 0.999270 0.999988 0.999983 0.000000
+1
View File
@@ -0,0 +1 @@
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0 0 0 0 0 0 0 0 0 0 0 0 8 0 1 0 0 0 0 3
3 Acidobacterium_capsulatum--ATCC_51196 0 0 203 119 128 141 140 116 109 111 78 112 0 136 109 147 134 117 55 129
4 Bacillus_subtilis--168 0 203 0 124 132 128 123 133 109 130 66 158 6 131 112 124 135 2393 46 124
5 Escherichia_coli--CFT073 0 119 124 0 1966777 1998059 1999094 117743 32029 22312 63 4225 0 74946 31918 73311 76585 113 128 7854
6 Escherichia_coli--EDL933 0 128 132 1966777 0 2627885 2628700 52488 20134 22064 48 4202 0 74655 28602 71244 74665 112 108 7963
7 Escherichia_coli--K-12_MG1655 0 141 128 1998059 2627885 0 4452541 48302 21382 24602 47 4277 0 75729 30449 73622 76778 119 111 8566
8 Escherichia_coli--K-12_W3110 0 140 123 1999094 2628700 4452541 0 47894 21226 24470 68 4278 0 75658 30207 73614 76583 112 108 8660
9 Klebsiella_pneumoniae--ATCC_13883 0 116 133 117743 52488 48302 47894 0 1416091 1477759 42 4172 0 48296 18988 48144 50416 120 106 7712
10 Klebsiella_pneumoniae--HS11286 0 109 109 32029 20134 21382 21226 1416091 0 644063 42 2738 0 21498 29758 21606 21376 99 102 4417
11 Klebsiella_pneumoniae--MGH_78578 0 111 130 22312 22064 24602 24470 1477759 644063 0 42 2614 0 19948 35067 21330 20813 97 102 4374
12 Opitutus_terrae--PB90-1 0 78 66 63 48 47 68 42 42 42 0 43 18 57 42 53 66 39 58 43
13 Proteus_mirabilis--HI4320 0 112 158 4225 4202 4277 4278 4172 2738 2614 43 0 0 4254 2481 4166 4215 131 103 4704
14 Saccharolobus_islandicus--M.16.4 8 0 6 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0
15 Salmonella_enterica--AKU_12601 0 136 131 74946 74655 75729 75658 48296 21498 19948 57 4254 0 0 1047731 2857146 2951421 117 108 7643
16 Salmonella_enterica--CT18 1 109 112 31918 28602 30449 30207 18988 29758 35067 42 2481 0 1047731 0 917948 940297 106 106 3716
17 Salmonella_enterica--LT2 0 147 124 73311 71244 73622 73614 48144 21606 21330 53 4166 0 2857146 917948 0 3284800 122 108 7460
18 Salmonella_enterica--P125109 0 134 135 76585 74665 76778 76583 50416 21376 20813 66 4215 0 2951421 940297 3284800 0 134 124 7645
19 Shouchella_clausii--KSM-K16 0 117 2393 113 112 119 112 120 99 97 39 131 0 117 106 122 134 0 58 124
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 0 55 46 128 108 111 108 106 102 102 58 103 0 108 106 108 124 58 0 96
21 Yersinia_ruckeri--YRB 3 129 124 7854 7963 8566 8660 7712 4417 4374 43 4704 0 7643 3716 7460 7645 124 96 0
+181
View File
@@ -0,0 +1,181 @@
#!/usr/bin/env python3
"""Compare an obikmer count index against a reference kmer set (presence + counts).
Loads the reference .npz (sorted uint64 kmers + uint32 counts from build_reference.py),
streams `obikmer dump` from a --with-counts index, then reports:
- false negatives : kmers in reference absent from the index
- false positives : kmers in the index absent from the reference
- count mismatches: kmers present in both but with differing counts
Output to stdout: one CSV row
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index(obikmer_bin: str, index_dir: str) -> tuple[np.ndarray, np.ndarray]:
"""Stream `obikmer dump` and return (kmers_sorted_uint64, counts_uint32)."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers, counts = [], []
header = True
for line in proc.stdout:
if header:
header = False
continue
parts = line.rstrip('\n').split(',')
kmers.append(encode_kmer(parts[0]))
counts.append(int(parts[1]))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
order = np.argsort(np.array(kmers, dtype=np.uint64), kind='stable')
return (np.array(kmers, dtype=np.uint64)[order],
np.array(counts, dtype=np.uint32)[order])
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref_kmers: np.ndarray, ref_counts: np.ndarray,
idx_kmers: np.ndarray, idx_counts: np.ndarray,
) -> tuple[np.ndarray, np.ndarray, np.ndarray, np.ndarray, np.ndarray]:
"""Return (false_neg, false_pos, cm_ref_kmers, cm_ref_counts, cm_idx_counts).
All arrays sorted; cm_* cover kmers present in both arrays but with
differing counts.
"""
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers.
# Both arrays are sorted so we can use searchsorted.
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
shared_ref_counts = ref_counts[shared_mask]
shared_idx_counts = idx_counts[pos_in_idx[shared_mask]]
mismatch_mask = shared_ref_counts != shared_idx_counts
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref_counts = shared_ref_counts[mismatch_mask]
cm_idx_counts = shared_idx_counts[mismatch_mask]
return false_neg, false_pos, cm_kmers, cm_ref_counts, cm_idx_counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?',
help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='obikmer index directory (built with --with-counts)')
ap.add_argument('--obikmer', default='obikmer',
help='Path to obikmer binary')
ap.add_argument('--species', default='')
ap.add_argument('--strain', default='')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
ap.add_argument('--save-cm', metavar='FILE',
help='Save count-mismatch rows (kmer,ref_count,idx_count) to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
# Detect k
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers, idx_counts = load_index(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos, cm_kmers, cm_ref, cm_idx = compare(
ref_kmers, ref_counts, idx_kmers, idx_counts)
n_shared = len(ref_kmers) - len(false_neg)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f'false negatives : {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives : {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
print(f'count mismatches: {len(cm_kmers):,} ({cm_pct:.4f}% of shared)',
file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_cm and len(cm_kmers):
with open(args.save_cm, 'w') as fh:
fh.write('kmer,ref_count,idx_count\n')
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
fh.write(f'{decode_kmer(int(v), k)},{rc},{ic}\n')
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
if __name__ == '__main__':
main()
+201
View File
@@ -0,0 +1,201 @@
#!/usr/bin/env python3
"""Verify the merged count index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer+count pairs from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_count.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, tuple[list[int], list[int]]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order
per_specimen : mapping label → (kmer_ints, counts) for entries > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:]
per_specimen: dict[str, tuple[list[int], list[int]]] = {
name: ([], []) for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
count = int(parts[i + 1])
if count > 0:
per_specimen[name][0].append(kmer_int)
per_specimen[name][1].append(count)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
count_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
save_cm: Path | None,
) -> str:
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
npz = np.load(ref_path)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
order = np.argsort(np.array(kmer_list, dtype=np.uint64), kind='stable')
idx_kmers = np.array(kmer_list, dtype=np.uint64)[order]
idx_counts = np.array(count_list, dtype=np.uint32)[order]
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
mismatch_mask = ref_counts[shared_mask] != idx_counts[pos_in_idx[shared_mask]]
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref = ref_counts[shared_mask][mismatch_mask]
cm_idx = idx_counts[pos_in_idx[shared_mask]][mismatch_mask]
n_shared = int(shared_mask.sum())
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%) '
f'cm={len(cm_kmers):,} ({cm_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
if save_cm and len(cm_kmers):
cm_file = save_cm / f'{name}_cm.csv'
lines = ['kmer,ref_count,idx_count']
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
lines.append(f'{decode_kmer(int(v), k)},{rc},{ic}')
cm_file.write_text('\n'.join(lines) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged count index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory for false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory for false-positive kmer lists')
ap.add_argument('--save-cm', metavar='DIR',
help='Directory for count-mismatch CSV files')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
save_cm = Path(args.save_cm) if args.save_cm else None
for d in (save_fn, save_fp, save_cm):
if d: d.mkdir(parents=True, exist_ok=True)
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
kmers, counts = per_specimen[name]
row = compare_specimen(name, kmers, counts, ref_dir, k,
save_fn, save_fp, save_cm)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_count"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_count"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_count.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'count_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/count_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+170
View File
@@ -0,0 +1,170 @@
#!/usr/bin/env python3
"""Verify the merged presence index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer sets from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_presence.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, list[int]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order (excluding 'kmer')
per_specimen : mapping label → list of kmer ints where presence > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:] # first col is 'kmer'
per_specimen: dict[str, list[int]] = {name: [] for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
if int(parts[i + 1]) > 0:
per_specimen[name].append(kmer_int)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
) -> str:
"""Compare one specimen column against its reference .npz.
Returns a CSV row string.
"""
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
ref_kmers = np.load(ref_path)['kmers'] # sorted uint64
idx_kmers = np.array(sorted(kmer_list), dtype=np.uint64)
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged presence index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory to save false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory to save false-positive kmer lists')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
if save_fn: save_fn.mkdir(parents=True, exist_ok=True)
if save_fp: save_fp.mkdir(parents=True, exist_ok=True)
# Detect k
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
row = compare_specimen(name, per_specimen[name], ref_dir, k, save_fn, save_fp)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_presence"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_presence"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_presence.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'presence_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/presence_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_count.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying count"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_presence.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying presence"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+139
View File
@@ -0,0 +1,139 @@
#!/usr/bin/env python3
"""Compare an obikmer index against a reference kmer set (presence/absence).
Loads the reference .npz (sorted uint64 kmers built by build_reference.py),
streams the output of `obikmer dump`, encodes each kmer string to uint64,
then reports false negatives and false positives using numpy set operations.
Output to stdout: one CSV row
species, strain, ref_kmers, idx_kmers, false_neg, false_pos, fn_pct, fp_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index_kmers(obikmer_bin: str, index_dir: str) -> np.ndarray:
"""Stream `obikmer dump` and return a sorted uint64 array of kmer integers."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers = []
header = True
for line in proc.stdout:
if header:
header = False
continue
kmer_str = line.split(',', 1)[0]
kmers.append(encode_kmer(kmer_str))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
arr = np.array(kmers, dtype=np.uint64)
arr.sort()
return arr
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref: np.ndarray, idx: np.ndarray) -> tuple[np.ndarray, np.ndarray]:
"""Return (false_negatives, false_positives) as uint64 arrays."""
false_neg = np.setdiff1d(ref, idx, assume_unique=True)
false_pos = np.setdiff1d(idx, ref, assume_unique=True)
return false_neg, false_pos
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?', help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?', help='obikmer index directory')
ap.add_argument('--obikmer', default='obikmer', help='Path to obikmer binary')
ap.add_argument('--species', default='', help='Species label for CSV row')
ap.add_argument('--strain', default='', help='Strain label for CSV row')
ap.add_argument('--header', action='store_true', help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
# Detect k from the index (one cheap call before the full dump).
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # already sorted uint64
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers = load_index_kmers(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos = compare(ref_kmers, idx_kmers)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f'false negatives: {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives: {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False negatives saved → {args.save_fn}', file=sys.stderr)
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False positives saved → {args.save_fp}', file=sys.stderr)
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
if __name__ == '__main__':
main()
+84
View File
@@ -638,6 +638,34 @@
<li class="md-nav__item">
<a href="/implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="/implementation/obilayeredmap/" class="md-nav__link">
@@ -716,6 +744,62 @@
<li class="md-nav__item">
<a href="/implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="/implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
@@ -9,7 +9,7 @@
<link rel="prev" href="../../../implementation/persistent_bit_vec/">
<link rel="prev" href="../../../implementation/rebuild_filter/">
<link rel="next" href="../../index_architecture/">
@@ -647,6 +647,34 @@
<li class="md-nav__item">
<a href="../../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../../implementation/obilayeredmap/" class="md-nav__link">
@@ -725,6 +753,62 @@
<li class="md-nav__item">
<a href="../../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
File diff suppressed because it is too large Load Diff
+101 -38
View File
@@ -243,19 +243,28 @@
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix="">
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<a class="md-nav__link" href="#two-reading-paths">
<span class="md-ellipsis">
Output type: rope
Two reading paths
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#allocation-policy">
<a class="md-nav__link" href="#record-path-chunk-reader">
<span class="md-ellipsis">
Allocation policy
Record path: chunk reader
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<span class="md-ellipsis">
Output type: Rope
</span>
</a>
@@ -347,6 +356,18 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../evidence_elimination/">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
@@ -383,6 +404,30 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../merge/">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../rebuild_filter/">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
@@ -454,19 +499,28 @@
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix="">
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<a class="md-nav__link" href="#two-reading-paths">
<span class="md-ellipsis">
Output type: rope
Two reading paths
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#allocation-policy">
<a class="md-nav__link" href="#record-path-chunk-reader">
<span class="md-ellipsis">
Allocation policy
Record path: chunk reader
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<span class="md-ellipsis">
Output type: Rope
</span>
</a>
@@ -506,68 +560,77 @@
<div class="md-content" data-md-component="content">
<article class="md-content__inner md-typeset">
<h1 id="chunk-reader-implementation">Chunk reader — implementation</h1>
<p>The <code>obiread</code> crate provides a streaming iterator that reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. Chunks are consumed in parallel by downstream workers.</p>
<h2 id="output-type-rope">Output type: rope</h2>
<p>Each chunk is a <code>Vec&lt;Bytes&gt;</code> — a <strong>rope</strong>: a list of reference-counted byte slices that are not necessarily contiguous in memory. The consumer iterates over the slices in order.</p>
<p>Using <code>bytes::Bytes</code> means the split at the record boundary is O(1): <code>Bytes::split_to(n)</code> adjusts a reference counter, not memory. No <code>memcpy</code> in the common case.</p>
<h2 id="allocation-policy">Allocation policy</h2>
<p><code>obiread</code> exposes two distinct sequence reading paths, each optimised for a different use case.</p>
<h2 id="two-reading-paths">Two reading paths</h2>
<table>
<thead>
<tr>
<th>Case</th>
<th>Cost</th>
<th>Path</th>
<th>API</th>
<th>Output unit</th>
<th>Per-record identity</th>
<th>Use case</th>
</tr>
</thead>
<tbody>
<tr>
<td>Boundary found in the current block (common)</td>
<td>zero extra allocation — <code>split_to</code> only</td>
<td><strong>Record path</strong></td>
<td><code>read_sequence_chunks</code> → <code>parse_chunk</code></td>
<td><code>SeqRecord</code> (id + raw sequence + normalised rope)</td>
<td>yes</td>
<td><code>query</code> — must read complete records</td>
</tr>
<tr>
<td>Boundary straddles multiple blocks (sequence &gt; block size, rare)</td>
<td>one allocation to pack the rope into a flat buffer</td>
</tr>
<tr>
<td>EOF flush</td>
<td>zero extra allocation</td>
<td><strong>Stream path</strong></td>
<td><code>open_nuc_stream</code></td>
<td><code>NucPage</code> (flat normalised byte buffer)</td>
<td>no</td>
<td><code>index</code>, <code>superkmer</code> — bulk throughput</td>
</tr>
</tbody>
</table>
<p>The record path uses <code>Rope</code>-backed chunks and is described in detail below.
The stream path (<code>NucStream</code> / <code>NucPage</code>) is described in the scatter section of <a href="../pipeline/">pipeline</a>.</p>
<hr/>
<h2 id="record-path-chunk-reader">Record path: chunk reader</h2>
<p>The chunk reader reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. <code>parse_chunk</code> then converts each chunk into a <code>Vec&lt;SeqRecord&gt;</code>, where each record carries its identifier, raw sequence bytes, and a normalised rope ready for superkmer building.</p>
<p>This path is mandatory for <code>query</code>, where superkmers must be tracked back to their originating sequence (id, kmer offset) for output annotation.</p>
<h2 id="output-type-rope">Output type: Rope</h2>
<p>Each chunk is a <code>Rope</code> — a segmented byte sequence: a <code>Vec</code> of blocks, where each block is a <code>Vec&lt;Cell&lt;u8&gt;&gt;</code>. The consumer iterates over the blocks via a forward or backward cursor.</p>
<p><code>Rope::split_off(pos)</code> splits at an absolute byte offset in O(log n) (binary search over block-start index). If <code>pos</code> falls inside a block, that block is split in two via <code>Vec::split_off</code> — no <code>memcpy</code> in the common case.</p>
<h2 id="seqchunkiter">SeqChunkIter</h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="cm">/* private */</span><span class="w"> </span><span class="p">}</span>
<span class="k">impl</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="nb">Iterator</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Item</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">io</span><span class="p">::</span><span class="nb">Result</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">Bytes</span><span class="o">&gt;&gt;</span><span class="p">;</span>
<span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Item</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">io</span><span class="p">::</span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Rope</span><span class="o">&gt;</span><span class="p">;</span>
<span class="p">}</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fasta_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fastq_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span>
</code></pre></div>
<p><code>next()</code> loop:</p>
<div class="highlight"><pre><span></span><code>1. read one block of block_size bytes → push onto rope
2. probe check: if the boundary marker ("\n&gt;" or "\n@") is absent from the
last block, skip the splitter (avoids a full backward scan for nothing)
3. call splitter on last block
if found at offset n:
remainder = last_block.split_to(n) ← O(1), zero copy
return std::mem::take(&amp;mut self.rope) ← the chunk
4. if rope.len() &gt; 1 (multi-block accumulation):
pack rope into one flat buffer ← one alloc
retry splitter on flat buffer
5. if EOF: flush remaining rope as final chunk
<div class="highlight"><pre><span></span><code>1. read one block of block_size bytes → push onto Rope
2. call splitter(rope) → Option&lt;abs_offset&gt;
if Some(pos):
tail = rope.split_off(pos) ← O(log n), may split one block
chunk = mem::replace(&amp;mut rope, tail)
return Some(Ok(chunk))
3. if EOF and rope non-empty: return Some(Ok(rope)) as final chunk
4. if EOF and rope empty: return None
</code></pre></div>
<p>The <code>Splitter</code> function signature is <code>fn(&amp;Rope) -&gt; Option&lt;usize&gt;</code>. It returns the absolute byte offset of the start of the last complete record, or <code>None</code> if no boundary was found in the accumulated rope (need more data).</p>
<h2 id="boundary-detection-fasta">Boundary detection — FASTA</h2>
<p>Backward scan with a 2-state machine. Searches for <code>&gt;</code> immediately preceded by <code>\n</code> or <code>\r</code>:</p>
<p>Backward scan with a 2-state machine. Searches (right to left) for <code>&gt;</code> followed by <code>\n</code> or <code>\r</code> (i.e., a <code>&gt;</code> that is preceded by a newline in forward order):</p>
<pre class="mermaid"><code>stateDiagram-v2
direction LR
[*] --&gt; Scanning
Scanning --&gt; FoundGt : '&gt;'
FoundGt --&gt; Scanning : other
FoundGt --&gt; [*] : '\\n' / '\\r' ✓</code></pre>
<p>Returns the byte offset of the <code>&gt;</code> that starts the last complete record.</p>
<p>Returns the byte offset of the <code>&gt;</code> that starts the last complete record. Returns <code>None</code> if only one <code>&gt;</code> is found (cannot confirm there is a prior complete record).</p>
<h2 id="boundary-detection-fastq">Boundary detection — FASTQ</h2>
<p>FASTQ records have a rigid 4-line structure (<code>@header</code>, sequence, <code>+</code>, quality). The <code>@</code> character (ASCII 64, Phred score 31) can appear legitimately in quality lines, making any forward heuristic unreliable. The backward scanner verifies the full structural context before accepting a candidate <code>@</code>.</p>
<p>7-state machine (port of Go's <code>EndOfLastFastqEntry</code>), scanning from <strong>right to left</strong>. Each time a <code>+</code> is found, its position is saved as <code>restart</code>; any state mismatch resets the scan to that position.</p>
<p>7-state machine (states 0–6), scanning from <strong>right to left</strong>. Each time a <code>+</code> is found, its position is saved as <code>restart</code>; any state mismatch resets the scan to that position.</p>
<pre class="mermaid"><code>stateDiagram-v2
direction LR
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+210 -21
View File
@@ -514,10 +514,21 @@
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#memory-layout" class="md-nav__link">
<a href="#types-and-layout" class="md-nav__link">
<span class="md-ellipsis">
Memory layout
Types and layout
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#global-parameters" class="md-nav__link">
<span class="md-ellipsis">
Global parameters
</span>
</a>
@@ -558,10 +569,32 @@
</li>
<li class="md-nav__item">
<a href="#canonical-form" class="md-nav__link">
<a href="#canonical-form-and-canonicalkmerof" class="md-nav__link">
<span class="md-ellipsis">
Canonical form
Canonical form and CanonicalKmerOf
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#sliding-window-helpers" class="md-nav__link">
<span class="md-ellipsis">
Sliding window helpers
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#hashing" class="md-nav__link">
<span class="md-ellipsis">
Hashing
</span>
</a>
@@ -751,6 +784,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -829,6 +890,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -973,10 +1090,21 @@
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#memory-layout" class="md-nav__link">
<a href="#types-and-layout" class="md-nav__link">
<span class="md-ellipsis">
Memory layout
Types and layout
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#global-parameters" class="md-nav__link">
<span class="md-ellipsis">
Global parameters
</span>
</a>
@@ -1017,10 +1145,32 @@
</li>
<li class="md-nav__item">
<a href="#canonical-form" class="md-nav__link">
<a href="#canonical-form-and-canonicalkmerof" class="md-nav__link">
<span class="md-ellipsis">
Canonical form
Canonical form and CanonicalKmerOf
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#sliding-window-helpers" class="md-nav__link">
<span class="md-ellipsis">
Sliding window helpers
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#hashing" class="md-nav__link">
<span class="md-ellipsis">
Hashing
</span>
</a>
@@ -1045,12 +1195,43 @@
<h1 id="kmer-implementation">Kmer — implementation</h1>
<h2 id="memory-layout">Memory layout</h2>
<p><code>Kmer</code> is a <code>#[repr(transparent)]</code> newtype over <code>u64</code>:</p>
<h2 id="types-and-layout">Types and layout</h2>
<p><code>KmerOf&lt;L&gt;</code> is a <code>#[repr(transparent)]</code> newtype over <code>u64</code> parameterized by a <code>KmerLength</code> marker:</p>
<div class="highlight"><pre><span></span><code><span class="cp">#[repr(transparent)]</span>
<span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">Kmer</span><span class="p">(</span><span class="kt">u64</span><span class="p">);</span>
<span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">KmerOf</span><span class="o">&lt;</span><span class="n">L</span><span class="p">:</span><span class="w"> </span><span class="nc">KmerLength</span><span class="o">&gt;</span><span class="p">(</span><span class="kt">u64</span><span class="p">,</span><span class="w"> </span><span class="n">PhantomData</span><span class="o">&lt;</span><span class="n">L</span><span class="o">&gt;</span><span class="p">);</span>
</code></pre></div>
<p>Nucleotides are packed 2 bits each, <strong>left-aligned</strong>, MSB-first. Nucleotide 0 occupies bits 63–62; nucleotide i occupies bits 63−2i and 62−2i. The low 64−2k bits are always zero. k is <strong>not stored</strong> — it is a parameter of every operation that needs it, and will be owned by the future collection-level indexer.</p>
<p>Three marker types implement <code>KmerLength</code>:</p>
<table>
<thead>
<tr>
<th>Marker</th>
<th><code>len()</code> source</th>
<th>Used for</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>KLen</code></td>
<td><code>params::k()</code></td>
<td>k-mers</td>
</tr>
<tr>
<td><code>MLen</code></td>
<td><code>params::m()</code></td>
<td>minimizers</td>
</tr>
<tr>
<td><code>ConstLen&lt;N&gt;</code></td>
<td>const generic <code>N</code></td>
<td>tests</td>
</tr>
</tbody>
</table>
<p>Public aliases:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Kmer</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">KmerOf</span><span class="o">&lt;</span><span class="n">KLen</span><span class="o">&gt;</span><span class="p">;</span><span class="w"> </span><span class="c1">// k-mer, global k</span>
<span class="k">pub</span><span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Minimizer</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">CanonicalKmerOf</span><span class="o">&lt;</span><span class="n">MLen</span><span class="o">&gt;</span><span class="p">;</span><span class="w"> </span><span class="c1">// canonical m-mer, global m</span>
</code></pre></div>
<p>Nucleotides are packed 2 bits each, <strong>left-aligned</strong>, MSB-first. Nucleotide 0 occupies bits 63–62; nucleotide i occupies bits 63−2i and 62−2i. The low 64−2·len bits are always zero. The length is <strong>not stored</strong> — every operation reads it from <code>L::len()</code>.</p>
<table>
<thead>
<tr>
@@ -1071,33 +1252,41 @@
</tr>
</tbody>
</table>
<h2 id="global-parameters">Global parameters</h2>
<p><code>params::set_k(k)</code> / <code>params::k()</code> and <code>params::set_m(m)</code> / <code>params::m()</code> are backed by <code>OnceLock&lt;usize&gt;</code> in production (write-once, panic on conflict) and by <code>thread_local! { Cell&lt;usize&gt; }</code> in test builds (per-thread, freely writable). <code>params::init(k, m)</code> sets both in one call.</p>
<h2 id="encoding">Encoding</h2>
<p><code>Kmer::from_ascii(ascii, k)</code> encodes the first k bytes of an ASCII slice using the shared <code>ENC</code> table (see <a href="../superkmer/#ascii-encoding-and-decoding">SuperKmer — ASCII encoding</a>):</p>
<p><code>KmerOf::&lt;L&gt;::from_ascii(ascii)</code> encodes the first <code>L::len()</code> bytes using the shared <code>ENC</code> table (see <a href="../superkmer/#ascii-encoding-and-decoding">SuperKmer — ASCII encoding</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">for</span><span class="w"> </span><span class="n">i</span><span class="w"> </span><span class="k">in</span><span class="w"> </span><span class="mi">0</span><span class="o">..</span><span class="n">k</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">val</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="n">encode_base</span><span class="p">(</span><span class="n">ascii</span><span class="p">[</span><span class="n">i</span><span class="p">])</span><span class="w"> </span><span class="k">as</span><span class="w"> </span><span class="kt">u64</span><span class="p">;</span>
<span class="p">}</span>
<span class="n">Kmer</span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">))</span>
<span class="n">KmerOf</span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">),</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
</code></pre></div>
<p>Zero allocation — result lives on the stack.</p>
<h2 id="decoding">Decoding</h2>
<p><code>write_ascii(k, buf)</code> appends k ASCII characters to a caller-supplied <code>Vec&lt;u8&gt;</code> using the shared <code>DEC4</code> table: one lookup per 4 nucleotides, two partial-byte lookups for the remainder. No allocation in the hot path.</p>
<p><code>to_ascii(k)</code> is a convenience wrapper that allocates and returns a <code>Vec&lt;u8&gt;</code>; intended for tests and display only.</p>
<p><code>write_ascii(writer)</code> writes k ASCII characters to any <code>W: Write</code> using the shared <code>DEC4</code> table: one lookup per 4 nucleotides, one partial lookup for the remainder. No allocation in the hot path.</p>
<p><code>to_ascii()</code> is a convenience wrapper that allocates and returns a <code>Vec&lt;u8&gt;</code>; intended for tests and display only.</p>
<h2 id="reverse-complement">Reverse complement</h2>
<p>Computed as pure arithmetic — no lookup table, no memory access:</p>
<div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="o">!</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="p">;</span><span class="w"> </span><span class="c1">// complement</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">swap_bytes</span><span class="p">();</span><span class="w"> </span><span class="c1">// reverse bytes</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">4</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">4</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap nibbles</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap 2-bit groups</span>
<span class="n">Kmer</span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">))</span>
<span class="n">KmerOf</span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">),</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
</code></pre></div>
<p>After complementing, bytes are reversed (<code>swap_bytes</code>), then nibbles, then 2-bit groups — restoring 2-bit nucleotides to their correct positions in reverse order. A final left-shift realigns to MSB. Zero allocation — result lives on the stack.</p>
<h2 id="canonical-form">Canonical form</h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">canonical</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">k</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">Self</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">revcomp</span><span class="p">(</span><span class="n">k</span><span class="p">);</span>
<span class="w"> </span><span class="k">if</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&lt;=</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="o">*</span><span class="bp">self</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="k">else</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="p">}</span>
<h2 id="canonical-form-and-canonicalkmerof">Canonical form and <code>CanonicalKmerOf</code></h2>
<p><code>canonical()</code> returns a <code>CanonicalKmerOf&lt;L&gt;</code> — a distinct newtype that carries the same <code>u64</code> layout but enforces the invariant that the stored value equals <code>min(kmer, revcomp)</code>:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">canonical</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">CanonicalKmerOf</span><span class="o">&lt;</span><span class="n">L</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">revcomp</span><span class="p">();</span>
<span class="w"> </span><span class="n">CanonicalKmerOf</span><span class="p">(</span><span class="k">if</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&lt;=</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="k">else</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">},</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
<span class="p">}</span>
</code></pre></div>
<p>Lexicographic minimum of forward and reverse-complement, comparing the raw <code>u64</code> values directly (left-aligned encoding makes this equivalent to nucleotide-wise comparison). Zero allocation — result lives on the stack.</p>
<p><code>CanonicalKmerOf::from_raw_unchecked(raw)</code> is the only other public constructor, for trusted paths such as deserialisation.</p>
<h2 id="sliding-window-helpers">Sliding window helpers</h2>
<p><code>push_right(nuc)</code> / <code>push_left(nuc)</code> shift the window by one base in O(1). <code>is_overlapping(other)</code> checks whether the last k−1 nucleotides of <code>self</code> equal the first k−1 of <code>other</code>.</p>
<h2 id="hashing">Hashing</h2>
<p><code>hash_kmer(raw: u64) -&gt; u64</code> computes <code>mix64(raw ^ 0x9e3779b97f4a7c15)</code>, the seeded splitmix64 finalizer. <code>CanonicalKmerOf::seq_hash()</code> delegates to <code>hash_kmer</code>.</p>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+175 -20
View File
@@ -757,6 +757,28 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidence-modes" class="md-nav__link">
<span class="md-ellipsis">
Evidence modes
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-functions" class="md-nav__link">
<span class="md-ellipsis">
Build functions
</span>
</a>
</li>
<li class="md-nav__item">
@@ -840,6 +862,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -918,6 +968,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1165,6 +1271,28 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidence-modes" class="md-nav__link">
<span class="md-ellipsis">
Evidence modes
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-functions" class="md-nav__link">
<span class="md-ellipsis">
Build functions
</span>
</a>
</li>
<li class="md-nav__item">
@@ -1226,26 +1354,26 @@
<h2 id="why-two-phases-are-needed">Why two phases are needed</h2>
<p>Kmer indexing per partition proceeds in two phases. The separation is necessary because the exact number of surviving unique kmers is not known until after counting and filtering low-abundance kmers.</p>
<h3 id="phase-1-provisional-mphf-kmer-spectrum">Phase 1 — provisional MPHF + kmer spectrum</h3>
<p>Implemented in <code>obikpartitionner::KmerPartition::count_kmer()</code>.</p>
<p>Implemented in <code>obikpartitionner::KmerPartition::count_kmer()</code> → <code>count_partition()</code>.</p>
<ol>
<li><strong>Pass 1</strong>: read the dereplicated superkmer file; enumerate all unique canonical kmers into a <code>HashSet</code>. Exact count known after this pass.</li>
<li><strong>Build a provisional MPHF</strong> (<code>GOFunction</code> from the <code>ph</code> crate) over the exact kmer set. Produces <code>mphf1.bin</code>.</li>
<li><strong>Create <code>counts1.bin</code></strong>: one zero-initialised <code>u32</code> per MPHF slot (mmap'd).</li>
<li><strong>Pass 2</strong>: re-read the dereplicated file; for each kmer, query <code>mphf1.get(kmer)</code> and atomically accumulate the superkmer count into <code>counts1[slot]</code>.</li>
<li><strong>External sort</strong>: read the dereplicated superkmer file; extract the raw <code>u64</code> canonical kmer value for every kmer of every superkmer. Sort in RAM-bounded chunks (adaptive budget: 40% of available RAM ÷ n_threads, minimum 1 M kmers per chunk), then k-way merge with inline dedup. Result: <code>sorted_unique.bin</code> — a flat array of f0 distinct sorted <code>u64</code> values. Exact kmer count f0 is known at this point.</li>
<li><strong>Build provisional MPHF</strong> (ptr_hash, same configuration as phase 2) over <code>sorted_unique.bin</code> using <code>new_from_par_iter</code>. Delete <code>sorted_unique.bin</code> immediately after. Persist to <code>mphf1.bin</code>.</li>
<li><strong>Create <code>counts1.bin</code></strong>: <code>PersistentCompactIntVec</code> with f0 slots, zero-initialised.</li>
<li><strong>Accumulation pass</strong>: re-read the dereplicated superkmer file; for each kmer in each superkmer, compute <code>slot = mphf.index(kmer.raw())</code> and increment <code>counts1[slot]</code> by the superkmer's COUNT.</li>
<li><strong>Build kmer frequency spectrum</strong> from <code>counts1</code>: histogram <code>{count → n_kmers}</code>, totals f0 (distinct kmers) and f1 (total abundance). Written to <code>kmer_spectrum_raw.json</code> per partition, then merged globally.</li>
</ol>
<p>Files produced per partition:</p>
<div class="highlight"><pre><span></span><code>part_XXXXX/
mphf1.bin — GOFunction (provisional MPHF, discarded after phase 2)
counts1.bin — [u32; n_kmers] kmer counts, mmap&#39;d
mphf1.bin — ptr_hash provisional MPHF (discarded after phase 2)
counts1.bin — PersistentCompactIntVec, f0 × u32 kmer counts
kmer_spectrum_raw.json — local frequency spectrum
</code></pre></div>
<h3 id="phase-2-definitive-mphf">Phase 2 — definitive MPHF</h3>
<p>After filtering (applying a min-count threshold derived from the spectrum) and building the local De Bruijn graph + unitigs (see <a href="../pipeline/">Construction pipeline</a>), the exact filtered kmer set is available via <code>unitigs.bin</code>.</p>
<p><code>MphfLayer::build</code> is called on the unitig file:</p>
<p><code>MphfLayer::build(dir, block_bits, mode: &amp;IndexMode, fill_slot)</code> is called on the unitig directory:</p>
<ol>
<li><strong>Pass 1</strong>: iterate all canonical kmers from <code>unitigs.bin</code> in parallel, build and store <code>mphf.bin</code> (ptr_hash).</li>
<li><strong>Pass 2</strong>: iterate sequentially, fill <code>evidence.bin</code>, call the mode-specific <code>fill_slot</code> callback.</li>
<li><strong>Pass 1</strong> (parallel): a <code>CanonicalKmerIter</code> — clonable via <code>Arc&lt;Mmap&gt;</code>, no file reopening — is passed directly to <code>new_from_par_iter</code> via <code>par_bridge()</code>. No <code>.idx</code> is read or created at this stage; parallelism is at partition/layer level, not within a single MPHF. Produces <code>mphf.bin</code>.</li>
<li><strong>Pass 2</strong> (sequential): iterate with <code>iter_indexed_canonical_kmers</code>; fill evidence files; call <code>fill_slot(slot, kmer)</code> callback per kmer. For Exact/Hybrid, <code>.idx</code> is written at the end of this pass — never earlier.</li>
</ol>
<p><code>mphf1.bin</code> and <code>counts1.bin</code> are no longer needed after phase 2 and can be deleted.</p>
<hr />
@@ -1265,13 +1393,11 @@
<p><strong>FMPH/FMPHGO</strong> (<code>ph</code> crate, Beling, ACM JEA 2023):</p>
<ul>
<li>~2.1 bits/key — most compact; good query speed; deterministic construction</li>
<li>Works well from an exact or slightly overestimated count</li>
<li><code>GOFunction</code> (group-oriented variant) is the specific type used</li>
<li><code>GOFunction</code> (group-oriented variant) was the original phase-1 choice; eliminated when the external sort made the exact count available at phase 1 as well</li>
</ul>
<h2 id="mphf-choice-per-phase">MPHF choice per phase</h2>
<p><strong>Phase 1</strong> (provisional, discarded after spectrum computation): <code>ph::fmph::GOFunction</code>. Compact, fast to build from the exact post-dedup kmer set. Query speed is secondary — the structure is only used during pass 2 of <code>count_kmer</code>.</p>
<p><strong>Phase 2</strong> (persistent, queried repeatedly): <strong>ptr_hash</strong>. Exact key count is available from the unitig index; ptr_hash query speed (≥2.1×) and construction speed (≥3.1× over FMPH) are the decisive factors. The 2.4 bits/key overhead is acceptable.</p>
<p>boomphf is eliminated: largest space overhead, streaming advantage does not apply.</p>
<p><strong>Both phases</strong>: <strong>ptr_hash</strong>, same type alias and construction parameters. The external sort (phase 1) and the unitig index (phase 2) both provide the exact key count before MPHF construction, so ptr_hash's requirement is satisfied in both cases. Using a single MPHF implementation removes the <code>ph</code> crate dependency.</p>
<p>boomphf: eliminated — largest space overhead, streaming advantage no longer needed. FMPH/GOFunction: eliminated — exact count available, ptr_hash is faster at equivalent compactness.</p>
<hr />
<h2 id="space-at-scale">Space at scale</h2>
<p>For 1 024 partitions × 100 M kmers/partition (phase 2 index, after filtering):</p>
@@ -1320,9 +1446,12 @@
<h3 id="layer-structure">Layer structure</h3>
<p>Each layer is a self-contained unit. See <a href="../obilayeredmap/">obilayeredmap</a> for the full on-disk layout. The MPHF-relevant files are:</p>
<div class="highlight"><pre><span></span><code>layer_i/
unitigs.bin — packed 2-bit nucleotide sequences (kmer evidence)
unitigs.bin — packed 2-bit nucleotide sequences (kmer evidence source)
unitigs.bin.idx — random-access block index (block_bits controls granularity)
mphf.bin — ptr_hash phase-2 MPHF
evidence.bin — n × u32: (chunk_id: 25 bits | rank: 7 bits) per slot
evidence.bin — n × (chunk_id: 25 bits | rank: 7 bits) per slot [exact mode]
fingerprint.bin — n × b-bit fingerprints per slot [approx mode]
[no layer_meta.json — mode stored once in partition-level meta.json]
</code></pre></div>
<p>Layers are <strong>disjoint</strong>: a canonical kmer belongs to exactly one layer. Layer 0 is built from dataset A. Adding dataset B:</p>
<ol>
@@ -1330,17 +1459,43 @@
<li>Collect kmers of B not present in any layer → set <code>B \ A</code>.</li>
<li>Build layer 1 from <code>B \ A</code> (dereplicate → count → De Bruijn → unitigs → <code>MphfLayer::build</code>).</li>
</ol>
<h3 id="evidence-modes">Evidence modes</h3>
<p>Three evidence modes are supported via <code>IndexMode</code>, stored once in <code>PartitionMeta</code> at partition root. There is no <code>layer_meta.json</code>.</p>
<p><strong>Exact</strong> (<code>IndexMode::Exact</code>): <code>evidence.bin</code> stores one <code>(chunk_id, rank)</code> pair per MPHF slot. Verification reconstructs the kmer and compares to the query. Zero false positives. <code>.idx</code> required at query time.</p>
<p><strong>Approx</strong> (<code>IndexMode::Approx { b, z }</code>): <code>fingerprint.bin</code> stores a b-bit hash per slot. False-positive rate 1/2^b per query; Findere z-parameter reduces window FP to ≈ 1/2^(b·z). No <code>.idx</code> written or needed.</p>
<p><strong>Hybrid</strong> (<code>IndexMode::Hybrid { b, z }</code>): both <code>fingerprint.bin</code> and <code>evidence.bin</code> + <code>.idx</code>. <code>find()</code> uses the fingerprint (O(1)); <code>find_strict()</code> uses exact evidence (O(1)).</p>
<h3 id="build-functions">Build functions</h3>
<div class="highlight"><pre><span></span><code>MphfLayer::build(dir, block_bits, mode: &amp;IndexMode, fill_slot)
Pass 1: CanonicalKmerIter + par_bridge() → build mphf.bin (no .idx used)
Pass 2: sequential iter → fill evidence files + call fill_slot
.idx written last for Exact/Hybrid (query-time only)
MphfLayer::build_exact_evidence(dir, block_bits)
Post-hoc: builds evidence.bin + .idx from existing mphf.bin + unitigs.bin
Uses open_sequential(); no .idx required on entry
MphfLayer::build_approx_evidence(dir, b, z)
Post-hoc: builds fingerprint.bin from existing mphf.bin + unitigs.bin
Uses open_sequential(); never writes .idx
</code></pre></div>
<p>There is no <code>build_evidence</code> dispatch wrapper. Callers choose the appropriate post-hoc build directly.</p>
<p>In <code>obikpartitionner</code>, <code>build_index_layer</code> receives <code>block_bits: u8</code> from <code>IndexConfig::block_bits</code> and forwards it directly to <code>Layer::build</code> and <code>Layer::build_approx_evidence</code>.</p>
<h3 id="membership-verification">Membership verification</h3>
<p>ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry: decode the kmer from <code>(chunk_id, rank)</code> and compare to the query. A mismatch means the kmer is absent from this layer; probe the next layer.</p>
<p>ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry:</p>
<ul>
<li><strong>Exact</strong>: decode <code>(chunk_id, rank)</code> from <code>evidence.bin</code>; reconstruct the kmer via <code>unitigs.verify_canonical_kmer</code>; compare to query.</li>
<li><strong>Approx</strong>: compare <code>kmer.seq_hash()</code> to the b-bit fingerprint stored at the slot.</li>
</ul>
<p>A mismatch in either mode means the kmer is absent from this layer; probe the next layer.</p>
<h3 id="query-algorithm">Query algorithm</h3>
<div class="highlight"><pre><span></span><code>fn query(kmer) → Option&lt;(layer_index, slot)&gt;:
for (i, layer) in layers.iter().enumerate():
slot = layer.mphf.index(kmer)
if layer.evidence.decode(slot) matches kmer:
if layer.evidence.matches(slot, kmer): // exact or approx dispatch
return Some((i, slot))
return None
</code></pre></div>
<p>Expected probe depth: 1 for kmers in layer 0. Each probe is a ptr_hash lookup (~10 ns) plus one evidence decode.</p>
<p><code>MphfLayer::find</code> dispatches on <code>LayerEvidence</code> at O(1) — no panicking <code>find_exact</code>/<code>find_approx</code> methods. <code>find_strict</code> always performs an exact check: O(1) for Exact/Hybrid, O(n) sequential scan for Approx. Expected probe depth: 1 for kmers in layer 0. Each probe is a ptr_hash lookup (~10 ns) plus one evidence check.</p>
<h3 id="merging-layers">Merging layers</h3>
<p>Two layer chains can be merged by re-indexing their union through the full pipeline. This is expensive (full rebuild) but produces an optimal single-layer index. Merge is a maintenance operation, not a query-path requirement.</p>
File diff suppressed because it is too large Load Diff
+557 -84
View File
@@ -9,7 +9,7 @@
<link rel="prev" href="../unitig_evidence/">
<link rel="prev" href="../evidence_elimination/">
<link rel="next" href="../persistent_compact_int_vec/">
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item md-nav__item--active">
@@ -729,6 +757,17 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#index-mode-homogeneity-invariant" class="md-nav__link">
<span class="md-ellipsis">
Index mode (homogeneity invariant)
</span>
</a>
</li>
<li class="md-nav__item">
@@ -740,6 +779,34 @@
</span>
</a>
<nav class="md-nav" aria-label="MphfLayer — autonomous kmer → slot mapping">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#query-api" class="md-nav__link">
<span class="md-ellipsis">
Query API
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-surface" class="md-nav__link">
<span class="md-ellipsis">
Build surface
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -751,6 +818,73 @@
</span>
</a>
<nav class="md-nav" aria-label="Layer\&lt;D: LayerData&gt; — MPHF + payload">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#build-signatures" class="md-nav__link">
<span class="md-ellipsis">
Build signatures
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#fingerprintvec-and-fingerprintvecwriter" class="md-nav__link">
<span class="md-ellipsis">
FingerprintVec and FingerprintVecWriter
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layeredmapd-collection-of-layers" class="md-nav__link">
<span class="md-ellipsis">
LayeredMap\&lt;D> — collection of layers
</span>
</a>
<nav class="md-nav" aria-label="LayeredMap\&lt;D&gt; — collection of layers">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#common-methods" class="md-nav__link">
<span class="md-ellipsis">
Common methods
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#push_layer" class="md-nav__link">
<span class="md-ellipsis">
push_layer
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -776,10 +910,10 @@
</li>
<li class="md-nav__item">
<a href="#evidence-encoding" class="md-nav__link">
<a href="#evidence-encoding-exact" class="md-nav__link">
<span class="md-ellipsis">
Evidence encoding
Evidence encoding (exact)
</span>
</a>
@@ -798,14 +932,53 @@
</li>
<li class="md-nav__item">
<a href="#query-path" class="md-nav__link">
<a href="#column-append-and-merge-support" class="md-nav__link">
<span class="md-ellipsis">
Query path
Column append and merge support
</span>
</a>
<nav class="md-nav" aria-label="Column append and merge support">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#layer-level-genome-column-append" class="md-nav__link">
<span class="md-ellipsis">
Layer-level genome column append
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-matrix-initialisation" class="md-nav__link">
<span class="md-ellipsis">
Presence matrix initialisation
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#why-the-mphf-is-never-rebuilt" class="md-nav__link">
<span class="md-ellipsis">
Why the MPHF is never rebuilt
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -895,6 +1068,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1058,6 +1287,17 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#index-mode-homogeneity-invariant" class="md-nav__link">
<span class="md-ellipsis">
Index mode (homogeneity invariant)
</span>
</a>
</li>
<li class="md-nav__item">
@@ -1069,6 +1309,34 @@
</span>
</a>
<nav class="md-nav" aria-label="MphfLayer — autonomous kmer → slot mapping">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#query-api" class="md-nav__link">
<span class="md-ellipsis">
Query API
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-surface" class="md-nav__link">
<span class="md-ellipsis">
Build surface
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -1080,6 +1348,73 @@
</span>
</a>
<nav class="md-nav" aria-label="Layer\&lt;D: LayerData&gt; — MPHF + payload">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#build-signatures" class="md-nav__link">
<span class="md-ellipsis">
Build signatures
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#fingerprintvec-and-fingerprintvecwriter" class="md-nav__link">
<span class="md-ellipsis">
FingerprintVec and FingerprintVecWriter
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layeredmapd-collection-of-layers" class="md-nav__link">
<span class="md-ellipsis">
LayeredMap\&lt;D> — collection of layers
</span>
</a>
<nav class="md-nav" aria-label="LayeredMap\&lt;D&gt; — collection of layers">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#common-methods" class="md-nav__link">
<span class="md-ellipsis">
Common methods
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#push_layer" class="md-nav__link">
<span class="md-ellipsis">
push_layer
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -1105,10 +1440,10 @@
</li>
<li class="md-nav__item">
<a href="#evidence-encoding" class="md-nav__link">
<a href="#evidence-encoding-exact" class="md-nav__link">
<span class="md-ellipsis">
Evidence encoding
Evidence encoding (exact)
</span>
</a>
@@ -1127,14 +1462,53 @@
</li>
<li class="md-nav__item">
<a href="#query-path" class="md-nav__link">
<a href="#column-append-and-merge-support" class="md-nav__link">
<span class="md-ellipsis">
Query path
Column append and merge support
</span>
</a>
<nav class="md-nav" aria-label="Column append and merge support">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#layer-level-genome-column-append" class="md-nav__link">
<span class="md-ellipsis">
Layer-level genome column append
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-matrix-initialisation" class="md-nav__link">
<span class="md-ellipsis">
Presence matrix initialisation
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#why-the-mphf-is-never-rebuilt" class="md-nav__link">
<span class="md-ellipsis">
Why the MPHF is never rebuilt
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
@@ -1178,7 +1552,7 @@
<h1 id="obilayeredmap-layered-kmer-index-crate">obilayeredmap — layered kmer index crate</h1>
<h2 id="purpose">Purpose</h2>
<p><code>obilayeredmap</code> implements a persistent, incrementally extensible kmer index. The index is organised in three levels: <strong>index root → partition → layer</strong>. Each layer covers a disjoint kmer set and wraps a <code>ptr_hash</code> MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.</p>
<p><code>obilayeredmap</code> implements a persistent, incrementally extensible kmer index. Each layer covers a disjoint kmer set and wraps a <code>ptr_hash</code> MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.</p>
<hr />
<h2 id="three-usage-modes">Three usage modes</h2>
<p>The MPHF + evidence infrastructure is the same for all modes. The <strong>payload</strong> varies.</p>
@@ -1214,34 +1588,65 @@
</table>
<p>Both <code>PersistentCompactIntMatrix</code> and <code>PersistentBitMatrix</code> come from the <code>obicompactvec</code> crate.</p>
<hr />
<h2 id="index-mode-homogeneity-invariant">Index mode (homogeneity invariant)</h2>
<p>A partitioned index is homogeneous: every layer within a partition shares the same mode. The mode is determined once at <code>LayeredMap::open()</code> from <code>PartitionMeta.mode</code> and passed to each <code>Layer::open()</code> — no per-layer file is read.</p>
<div class="highlight"><pre><span></span><code><span class="cp">#[derive(Serialize, Deserialize, Default)]</span>
<span class="cp">#[serde(tag = </span><span class="s">&quot;type&quot;</span><span class="cp">, rename_all = </span><span class="s">&quot;snake_case&quot;</span><span class="cp">)]</span>
<span class="k">pub</span><span class="w"> </span><span class="k">enum</span><span class="w"> </span><span class="nc">IndexMode</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="cp">#[default]</span>
<span class="w"> </span><span class="n">Exact</span><span class="p">,</span>
<span class="w"> </span><span class="n">Approx</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="n">Hybrid</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="w"> </span><span class="p">},</span>
<span class="p">}</span>
</code></pre></div>
<p><code>IndexMode</code> is stored once in <code>PartitionMeta</code> (<code>meta.json</code> at partition root). There is no <code>layer_meta.json</code>.</p>
<ul>
<li><strong>Exact</strong>: writes <code>evidence.bin</code> + <code>unitigs.bin.idx</code>. Zero false positives.</li>
<li><strong>Approx</strong>: writes <code>fingerprint.bin</code> only. FP rate per kmer = 1/2^b; with Findere z-parameter, z consecutive kmers must all match → effective window FP ≈ 1/2^(b·z). No <code>.idx</code> written or required.</li>
<li><strong>Hybrid</strong>: writes both <code>fingerprint.bin</code> and <code>evidence.bin</code> + <code>.idx</code>. <code>find()</code> uses the fingerprint (fast, O(1)); <code>find_strict()</code> uses exact evidence.</li>
</ul>
<hr />
<h2 id="mphflayer-autonomous-kmer-slot-mapping">MphfLayer — autonomous kmer → slot mapping</h2>
<p><code>MphfLayer</code> encapsulates the MPHF + evidence + unitig spine for one layer. It is independent of any payload data.</p>
<p><code>MphfLayer</code> encapsulates the MPHF and evidence store for one layer. It is independent of any payload.</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">MphfLayer</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">mphf</span><span class="p">:</span><span class="w"> </span><span class="nc">Mphf</span><span class="p">,</span>
<span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span>
<span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="p">,</span>
<span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="c1">// number of indexed kmers = number of MPHF slots</span>
<span class="w"> </span><span class="n">mphf</span><span class="p">:</span><span class="w"> </span><span class="nc">Mphf</span><span class="p">,</span>
<span class="w"> </span><span class="n">ev</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerEvidence</span><span class="p">,</span><span class="w"> </span><span class="c1">// loaded at open() time</span>
<span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p>Public API:</p>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">MphfLayer</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span><span class="w"> </span><span class="c1">// Some(slot) or None</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">unitig_writer</span><span class="p">(</span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="n">UnitigFileWriter</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span>
<span class="w"> </span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span>
<span class="w"> </span><span class="n">fill_slot</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">mut</span><span class="w"> </span><span class="k">impl</span><span class="w"> </span><span class="nb">FnMut</span><span class="p">(</span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="p">,</span>
<span class="w"> </span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<p><code>LayerEvidence</code> is an internal enum, not public:</p>
<div class="highlight"><pre><span></span><code><span class="k">enum</span><span class="w"> </span><span class="nc">LayerEvidence</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">Exact</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="n">Approx</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="nc">FingerprintVec</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs_path</span><span class="p">:</span><span class="w"> </span><span class="nc">PathBuf</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="n">Hybrid</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="p">,</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="nc">FingerprintVec</span><span class="w"> </span><span class="p">},</span>
<span class="p">}</span>
</code></pre></div>
<p><code>find</code> returns <code>Some(slot)</code> only after verifying via evidence that the kmer is actually indexed. It returns <code>None</code> for absent keys (ptr_hash maps any input to a valid slot; evidence verification is the only correct-membership test).</p>
<p><code>build</code> runs two sequential passes over <code>unitigs.bin</code>:</p>
<p><code>MphfLayer::open(dir, mode: &amp;IndexMode)</code> receives the mode from <code>PartitionMeta</code> — no per-layer file is read.</p>
<h3 id="query-api">Query API</h3>
<p>Two public query methods, both returning <code>Option&lt;usize&gt;</code> (slot index):</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find_strict</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
</code></pre></div>
<ul>
<li><code>find</code>: O(1) auto-dispatch. Exact/Hybrid → exact evidence check. Approx/Hybrid → fingerprint comparison.</li>
<li><code>find_strict</code>: always exact. Exact/Hybrid → O(1) evidence check. Approx → O(n) sequential scan (no <code>.idx</code>).</li>
</ul>
<p>There are no <code>find_exact</code>/<code>find_approx</code> methods; panicking dispatch is eliminated.</p>
<h3 id="build-surface">Build surface</h3>
<div class="highlight"><pre><span></span><code><span class="c1">// Full MPHF + evidence build (two-pass)</span>
<span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span><span class="w"> </span><span class="n">fill_slot</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="c1">// Evidence-only post-hoc builds (MPHF already present)</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_exact_evidence</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_approx_evidence</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">b</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
</code></pre></div>
<p><code>MphfLayer::build</code> runs two passes over <code>unitigs.bin</code>:</p>
<ol>
<li><strong>Pass 1</strong>: iterate all canonical kmers in parallel via rayon, construct and store <code>mphf.bin</code>. <code>new_from_par_iter</code> avoids materialising a full key <code>Vec</code>.</li>
<li><strong>Pass 2</strong>: iterate again sequentially, fill <code>evidence.bin</code>, call <code>fill_slot(slot, kmer)</code> once per kmer for payload population. A compact <code>n/8</code>-byte seen-bitset verifies MPHF injectivity inline.</li>
<li><strong>Pass 1</strong> (parallel via rayon): a <code>CanonicalKmerIter</code> (clonable, <code>Arc&lt;Mmap&gt;</code>, no file reopening) is passed to <code>new_from_par_iter</code> via <code>par_bridge()</code>. Produces <code>mphf.bin</code>. No <code>.idx</code> is read or created at this stage.</li>
<li><strong>Pass 2</strong> (sequential): fill evidence files; call <code>fill_slot(slot, kmer)</code> per kmer. <code>.idx</code> is written last for Exact/Hybrid modes (query-time only).</li>
</ol>
<p>For empty layers (n = 0), <code>build</code> returns <code>Ok(0)</code> immediately after creating empty <code>mphf.bin</code> and <code>evidence.bin</code>.</p>
<p>There is no <code>build_evidence</code> dispatch wrapper — callers invoke <code>build_exact_evidence</code> or <code>build_approx_evidence</code> directly.</p>
<p>For empty layers (n = 0), all build variants return <code>Ok(0)</code> immediately after creating empty output files.</p>
<hr />
<h2 id="layerd-layerdata-mphf-payload">Layer\&lt;D: LayerData&gt; — MPHF + payload</h2>
<p><code>Layer&lt;D&gt;</code> pairs an <code>MphfLayer</code> with one payload store.</p>
@@ -1261,7 +1666,7 @@
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="n">data</span><span class="p">:</span><span class="w"> </span><span class="nc">T</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p><code>LayerData</code> covers the <strong>read path only</strong> (<code>open</code> + <code>read</code>). Build signatures differ between modes and are not in the trait.</p>
<p><code>LayerData</code> covers the <strong>read path only</strong> (<code>open</code> + <code>read</code>). Build signatures differ between modes and are not part of the trait.</p>
<table>
<thead>
<tr>
@@ -1288,28 +1693,89 @@
</tr>
</tbody>
</table>
<p><strong>Build signatures:</strong></p>
<h3 id="build-signatures">Build signatures</h3>
<div class="highlight"><pre><span></span><code><span class="c1">// mode 1</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="c1">// mode 2</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_from_map</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_from_map</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="c1">// mode 3</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentBitMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_presence</span><span class="p">(</span>
<span class="w"> </span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span>
<span class="w"> </span><span class="n">n_genomes</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span>
<span class="w"> </span><span class="n">present_in</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">,</span>
<span class="w"> </span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_presence</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="n">n_genomes</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span>
<span class="w"> </span><span class="n">present_in</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>All build impls delegate MPHF + evidence construction to <code>MphfLayer::build</code> via a mode-specific <code>fill_slot</code> callback. Mode 2 pre-reads <code>n_kmers</code> from <code>unitigs.bin</code> to size the <code>PersistentCompactIntMatrixBuilder</code> before calling <code>MphfLayer::build</code>. Mode 3 does the same for <code>PersistentBitMatrixBuilder</code>.</p>
<p>All build impls delegate to <code>MphfLayer::build</code> via a mode-specific <code>fill_slot</code> callback. The <code>mode</code> parameter is forwarded directly — no <code>LayerMeta</code> is written.</p>
<p>Evidence-only post-hoc builds are accessible directly on <code>Layer&lt;D&gt;</code>:</p>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="o">&lt;</span><span class="n">D</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerData</span><span class="o">&gt;</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_exact_evidence</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_approx_evidence</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>There is no <code>build_evidence</code> dispatch wrapper.</p>
<hr />
<h2 id="fingerprintvec-and-fingerprintvecwriter">FingerprintVec and FingerprintVecWriter</h2>
<p>Approximate evidence is stored as a packed b-bit array, one fingerprint per MPHF slot.</p>
<div class="highlight"><pre><span></span><code>fingerprint.bin format:
magic: b&quot;FPVF&quot; (4 bytes)
b: u8 (bits per fingerprint, 1..=64)
padding: [0u8; 3]
n: u64 LE (number of slots)
data: packed bits, ceil(n*b/8) bytes, Lsb0 order
</code></pre></div>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">FingerprintVec</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">path</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">get</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">slot</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u64</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">matches</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">slot</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="kt">u64</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">b</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u8</span>
<span class="p">}</span>
</code></pre></div>
<p><code>matches(slot, hash)</code> extracts the b-bit fingerprint stored at <code>slot</code> and compares it to the low b bits of <code>hash</code>. It is the core operation of <code>find_approx</code>.</p>
<hr />
<h2 id="layeredmapd-collection-of-layers">LayeredMap\&lt;D&gt; — collection of layers</h2>
<p><code>LayeredMap&lt;D&gt;</code> wraps <code>Vec&lt;Layer&lt;D&gt;&gt;</code> for a single partition directory.</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">LayeredMap</span><span class="o">&lt;</span><span class="n">D</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerData</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="nc">PathBuf</span><span class="p">,</span>
<span class="w"> </span><span class="n">meta</span><span class="p">:</span><span class="w"> </span><span class="nc">PartitionMeta</span><span class="p">,</span>
<span class="w"> </span><span class="n">layers</span><span class="p">:</span><span class="w"> </span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;&gt;</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p><code>PartitionMeta</code> (<code>meta.json</code> at the partition root) stores <code>n_layers</code>.</p>
<h3 id="common-methods">Common methods</h3>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">create</span><span class="p">(</span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="nc">IndexMode</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n_layers</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span>
<span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">layer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">mode</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">query</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="p">(</span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">Hit</span><span class="o">&lt;</span><span class="n">D</span><span class="p">::</span><span class="n">Item</span><span class="o">&gt;</span><span class="p">)</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">next_layer_writer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="n">UnitigFileWriter</span><span class="o">&gt;</span>
</code></pre></div>
<p><code>open</code> reads <code>PartitionMeta</code> once, extracts <code>mode</code>, and passes it to every <code>Layer::open</code> — no per-layer file is read. <code>create</code> stores the given mode in <code>PartitionMeta</code>.</p>
<p><code>query</code> probes layers in order and returns <code>(layer_index, Hit)</code> on the first match. Expected probe depth: 1 for kmers in layer 0.</p>
<h3 id="push_layer">push_layer</h3>
<p><code>push_layer</code> builds the next layer from a <code>unitigs.bin</code> already written via <code>next_layer_writer</code>, using <code>DEFAULT_BLOCK_BITS</code>:</p>
<div class="highlight"><pre><span></span><code><span class="c1">// mode 1</span>
<span class="k">impl</span><span class="w"> </span><span class="n">LayeredMap</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="c1">// mode 2</span>
<span class="k">impl</span><span class="w"> </span><span class="n">LayeredMap</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer_from_map</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>Mode 3 (<code>PersistentBitMatrix</code>) has no <code>push_layer</code> on <code>LayeredMap</code>; callers build directly via <code>Layer&lt;PersistentBitMatrix&gt;::build_presence</code>.</p>
<hr />
<h2 id="layeredstores-and-aggregation-traits">LayeredStore\&lt;S&gt; and aggregation traits</h2>
<p><code>LayeredStore&lt;S&gt;</code> is a generic aggregation wrapper over <code>Vec&lt;S&gt;</code>. It propagates three traits from <code>obicompactvec::traits</code> up the hierarchy via blanket impls:</p>
@@ -1320,11 +1786,6 @@
<span class="k">impl</span><span class="o">&lt;</span><span class="n">S</span><span class="p">:</span><span class="w"> </span><span class="nc">BitPartials</span><span class="o">&gt;</span><span class="w"> </span><span class="n">BitPartials</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">LayeredStore</span><span class="o">&lt;</span><span class="n">S</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="err">…</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="c1">// element-wise Σ partials</span>
</code></pre></div>
<p>Because blanket impls compose, <code>LayeredStore&lt;LayeredStore&lt;S&gt;&gt;</code> automatically inherits all three traits when <code>S</code> does — providing the partitioned level without a separate type.</p>
<p><strong>Aggregation hierarchy:</strong></p>
<div class="highlight"><pre><span></span><code>PersistentCompactIntMatrix implements CountPartials
LayeredStore&lt;PersistentCompactIntMatrix&gt; via blanket impl (one partition)
LayeredStore&lt;LayeredStore&lt;…&gt;&gt; via blanket impl (partitioned index)
</code></pre></div>
<p><strong>Leaf implementors</strong> (in <code>obicompactvec</code>):</p>
<table>
<thead>
@@ -1344,69 +1805,77 @@ LayeredStore&lt;LayeredStore&lt;…&gt;&gt; via blanket impl
</tr>
</tbody>
</table>
<p><code>PersistentCompactIntVec</code> and <code>PersistentBitVec</code> do not implement these traits — they are single-column primitives, not matrix-level aggregators.</p>
<p>See <a href="../../architecture/index_architecture/">Kmer index architecture</a> for the full trait API and the two-pass normalised-metric pattern.</p>
<hr />
<h2 id="on-disk-structure">On-disk structure</h2>
<div class="highlight"><pre><span></span><code>index_root/ ← LayeredMap (collection)
meta.json
part_00000/ ← Partition
layer_0/ ← Layer
mphf.bin — ptr_hash MPHF (epserde format)
unitigs.bin — packed 2-bit nucleotide sequences
unitigs.bin.idx — UIDX index: n_unitigs, n_kmers, seqls[], packed_offsets[]
evidence.bin — n × u32, each = (chunk_id: 25 bits | rank: 7 bits), LE
counts/ [mode 2] PersistentCompactIntMatrix
meta.json {&quot;n&quot;: N, &quot;n_cols&quot;: 1}
col_000000.pciv
presence/ [mode 3] PersistentBitMatrix
meta.json {&quot;n&quot;: N, &quot;n_cols&quot;: G}
col_000000.pbiv
…
layer_1/
…
part_00001/
<div class="highlight"><pre><span></span><code>partition_root/ ← LayeredMap (one partition)
meta.json — {&quot;n_layers&quot;: N, &quot;mode&quot;: {&quot;type&quot;: &quot;exact&quot;|&quot;approx&quot;|&quot;hybrid&quot;, ...}}
layer_0/ ← Layer
mphf.bin — ptr_hash MPHF (epserde format)
unitigs.bin — packed 2-bit nucleotide sequences
unitigs.bin.idx — UIDX index (Exact/Hybrid only; query-time, never built during MPHF construction)
evidence.bin — [u32; n], LE (Exact/Hybrid only)
fingerprint.bin — packed b-bit array (Approx/Hybrid only)
counts/ [mode 2] PersistentCompactIntMatrix
meta.json
col_000000.pciv
presence/ [mode 3] PersistentBitMatrix
meta.json
col_000000.pbiv …
layer_1/
…
</code></pre></div>
<p><strong>Partition</strong> (<code>part_XXXXX/</code>): all kmers whose canonical minimiser hashes to this bucket. Partitions are independent and can be processed in parallel.</p>
<p><strong>Layer</strong> (<code>layer_N/</code>): one <code>MphfLayer</code> plus optional payload. Layer 0 covers dataset A; layer 1 covers kmers in B absent from A; etc. Layers within a partition are always disjoint.</p>
<p>There is no <code>layer_meta.json</code>. The mode is stored once in <code>PartitionMeta</code> and is valid for all layers. <code>unitigs.bin.idx</code> is built at the end of <code>build_exact_evidence</code> — never during MPHF construction — and is consumed at query time only.</p>
<hr />
<h2 id="evidence-encoding">Evidence encoding</h2>
<h2 id="evidence-encoding-exact">Evidence encoding (exact)</h2>
<p><code>evidence.bin</code> is a flat <code>[u32; n]</code> array with no header. Each u32 encodes one slot:</p>
<div class="highlight"><pre><span></span><code>bits [31:7] = chunk_id (25 bits) — index of the unitig chunk
bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
</code></pre></div>
<p>Decoding: <code>chunk_id = raw &gt;&gt; 7</code>, <code>rank = raw &amp; 0x7F</code>. Reconstructing the kmer: read k nucleotides at position <code>rank</code> within unitig <code>chunk_id</code>.</p>
<p>For k=31, m=11, the observed maximum is ~46 kmers per chunk — well within the 127-kmer u7 capacity. The structural maximum from superkmer construction is k − m + 1 = 21 kmers/unitig; longer unitigs arise from paths spanning more than one superkmer.</p>
<p><code>chunk_id = raw &gt;&gt; 7</code>, <code>rank = raw &amp; 0x7F</code>. Reconstructing the kmer: read k nucleotides at position <code>rank</code> within unitig <code>chunk_id</code> (requires <code>unitigs.bin.idx</code> for random access).</p>
<p>For k=31, m=11, the observed maximum is ~46 kmers per chunk — well within the 127-kmer u7 capacity.</p>
<hr />
<h2 id="ptr_hash-configuration">ptr_hash configuration</h2>
<div class="highlight"><pre><span></span><code><span class="k">type</span><span class="w"> </span><span class="nc">Mphf</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">PtrHash</span><span class="o">&lt;</span>
<span class="w"> </span><span class="kt">u64</span><span class="p">,</span><span class="w"> </span><span class="c1">// key type: canonical kmer raw encoding</span>
<span class="w"> </span><span class="n">CubicEps</span><span class="p">,</span><span class="w"> </span><span class="c1">// bucket fn: 2.4 bits/key, λ=3.5, α=0.99</span>
<span class="w"> </span><span class="n">CachelineEfVec</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">CachelineEf</span><span class="o">&gt;&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// remap: 11.6 bits/entry (Elias-Fano)</span>
<span class="w"> </span><span class="n">CachelineEfVec</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">CachelineEf</span><span class="o">&gt;&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// remap: Elias-Fano</span>
<span class="w"> </span><span class="n">Xx64</span><span class="p">,</span><span class="w"> </span><span class="c1">// hasher: XXH3-64 with seed</span>
<span class="w"> </span><span class="nb">Vec</span><span class="o">&lt;</span><span class="kt">u8</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// pilots</span>
<span class="o">&gt;</span><span class="p">;</span>
</code></pre></div>
<p><code>Xx64</code> is chosen over <code>FxHash</code> because canonical kmer raw values are left-aligned u64 with structural zeros in the low bits (42 zeros for k=11, 2 zeros for k=31), which single-multiply hashes distribute poorly.</p>
<p><code>CubicEps</code> with <code>PtrHashParams::&lt;CubicEps&gt;::default()</code> (λ=3.5) is a balanced tradeoff: 2× slower construction than <code>Linear/λ=3.0</code>, 20% less space.</p>
<p><code>CubicEps</code> with <code>PtrHashParams::&lt;CubicEps&gt;::default()</code> (λ=3.5): 2× slower construction than <code>Linear/λ=3.0</code>, ~20% less space.</p>
<hr />
<h2 id="query-path">Query path</h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">query</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="n">Hit</span><span class="o">&lt;</span><span class="n">D</span><span class="p">::</span><span class="n">Item</span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">mphf</span><span class="p">.</span><span class="n">find</span><span class="p">(</span><span class="n">kmer</span><span class="p">).</span><span class="n">map</span><span class="p">(</span><span class="o">|</span><span class="n">slot</span><span class="o">|</span><span class="w"> </span><span class="n">Hit</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">slot</span><span class="p">,</span><span class="w"> </span><span class="n">data</span><span class="p">:</span><span class="w"> </span><span class="nc">self</span><span class="p">.</span><span class="n">data</span><span class="p">.</span><span class="n">read</span><span class="p">(</span><span class="n">slot</span><span class="p">)</span><span class="w"> </span><span class="p">})</span>
<h2 id="column-append-and-merge-support">Column append and merge support</h2>
<p>These methods extend existing layers with new genome columns without touching the MPHF.</p>
<h3 id="layer-level-genome-column-append">Layer-level genome column append</h3>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentBitMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">append_genome_column</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">value_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">append_genome_column</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">value_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p><code>MphfLayer::find</code> probes the MPHF, decodes evidence, and verifies the kmer — returning <code>Some(slot)</code> on match, <code>None</code> otherwise. <code>data.read(slot)</code> is called only on a confirmed hit.</p>
<p>In <code>LayeredMap</code>, layers are probed in order; the first match wins. Expected probe depth: 1 for kmers in layer 0.</p>
<p>Both delegate to the corresponding <code>PersistentBitMatrix::append_column</code> / <code>PersistentCompactIntMatrix::append_column</code>. They write a new column file (<code>col_NNNNNN.pbiv</code> / <code>col_NNNNNN.pciv</code>) and update <code>meta.json</code> to increment <code>n_cols</code>. <code>value_of</code> is called once per slot (0..n).</p>
<h3 id="presence-matrix-initialisation">Presence matrix initialisation</h3>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">init_presence_matrix</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">n_kmers</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>Called on the first merge of a Presence-mode index. Creates <code>presence/</code> with <code>meta.json {"n": n_kmers, "n_cols": 1}</code> and <code>col_000000.pbiv</code> set entirely to <code>true</code>. This retroactively records genome 0 (the original source) as present in every slot, satisfying the column-count invariant before any new-source column is appended.</p>
<h3 id="why-the-mphf-is-never-rebuilt">Why the MPHF is never rebuilt</h3>
<p>The MPHF, evidence, and unitigs are built once from the kmer set of a layer and are immutable for the lifetime of that layer. Adding a genome column does not change the kmer set — it only appends a new data column indexed by the same slot numbers. The only disk writes are one new <code>.pciv</code>/<code>.pbiv</code> file and a single <code>meta.json</code> update.</p>
<hr />
<h2 id="add-layer-algorithm">Add-layer algorithm</h2>
<p>When adding dataset B to an existing index:</p>
<ol>
<li>For each partition, probe existing layers for kmers of B routed to that partition.</li>
<li>Collect kmers absent from all layers → <code>B \ index</code>.</li>
<li>Write <code>B \ index</code> to a new <code>unitigs.bin</code> via <code>MphfLayer::unitig_writer</code>.</li>
<li>Call <code>Layer&lt;D&gt;::build</code> on the new directory.</li>
<li>Update <code>meta.json</code>.</li>
<li>Write <code>B \ index</code> to a new <code>unitigs.bin</code> via <code>next_layer_writer()</code>.</li>
<li>Call <code>Layer&lt;D&gt;::build</code> (or <code>build_presence</code>) on the new layer directory.</li>
<li>Call <code>push_layer</code> (or <code>append_layer</code>) to register the new layer in <code>meta.json</code>.</li>
</ol>
<p>Each partition's new layer is built independently; the operation is fully parallel across partitions.</p>
<hr />
@@ -1433,11 +1902,15 @@ bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
</tr>
<tr>
<td><code>memmap2 0.9</code></td>
<td>mmap of evidence and payload files</td>
<td>mmap of evidence and fingerprint files</td>
</tr>
<tr>
<td><code>bitvec</code></td>
<td>packed b-bit fingerprint storage</td>
</tr>
<tr>
<td><code>obiskio</code></td>
<td>unitig file writer/reader</td>
<td>unitig file writer/reader + <code>.idx</code> build</td>
</tr>
<tr>
<td><code>obicompactvec</code></td>
@@ -1448,8 +1921,8 @@ bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
<td>parallel MPHF construction pass</td>
</tr>
<tr>
<td><code>ndarray 0.16</code></td>
<td>aggregation output arrays</td>
<td><code>serde / serde_json</code></td>
<td><code>PartitionMeta</code> serialisation</td>
</tr>
</tbody>
</table>
File diff suppressed because it is too large Load Diff
+155 -21
View File
@@ -662,6 +662,17 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#make_pipe-dsl" class="md-nav__link">
<span class="md-ellipsis">
make_pipe! DSL
</span>
</a>
</li>
</ul>
@@ -801,6 +812,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -879,6 +918,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1087,6 +1182,17 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#make_pipe-dsl" class="md-nav__link">
<span class="md-ellipsis">
make_pipe! DSL
</span>
</a>
</li>
</ul>
@@ -1145,7 +1251,7 @@
<h1 id="obipipeline-parallel-pipeline-library">obipipeline — parallel pipeline library</h1>
<p><code>obipipeline</code> is a generic, multi-threaded data pipeline crate. It connects a <strong>source</strong>, a chain of <strong>transforms</strong>, and a <strong>sink</strong> via crossbeam channels, running each stage with a shared worker pool and a biased scheduler.</p>
<p><code>obipipeline</code> is a generic, multi-threaded data pipeline crate. It connects a <strong>source</strong>, a chain of <strong>stages</strong>, and a <strong>sink</strong> via crossbeam channels, running each stage with a shared worker pool and a biased scheduler.</p>
<h2 id="core-types">Core types</h2>
<table>
<thead>
@@ -1158,22 +1264,33 @@
<tbody>
<tr>
<td><code>SourceFn&lt;D&gt;</code></td>
<td><code>Box&lt;dyn FnMut() -&gt; Result&lt;D, PipelineError&gt; + Send+Sync&gt;</code></td>
<td><code>Box&lt;dyn FnMut() -&gt; Result&lt;D, PipelineError&gt; + Send&gt;</code></td>
<td>Called repeatedly; <code>FnMut</code> because it holds iterator state</td>
</tr>
<tr>
<td><code>SharedFn&lt;D&gt;</code></td>
<td><code>Arc&lt;dyn Fn(D) -&gt; Result&lt;D, PipelineError&gt; + Send+Sync&gt;</code></td>
<td>Shared across workers via <code>Arc::clone</code> (no copy of the closure)</td>
<td><code>Arc&lt;dyn Fn(D) -&gt; Result&lt;D, PipelineError&gt; + Send + Sync&gt;</code></td>
<td>1→1 transform shared across workers via <code>Arc::clone</code></td>
</tr>
<tr>
<td><code>SharedFlatFn&lt;D&gt;</code></td>
<td><code>Arc&lt;dyn Fn(D, &amp;Sender&lt;Result&lt;D, _&gt;&gt;, &amp;Sender&lt;isize&gt;) + Send + Sync&gt;</code></td>
<td>1→N transform; pushes items into channel, sends delta</td>
</tr>
<tr>
<td><code>SinkFn&lt;D&gt;</code></td>
<td><code>Box&lt;dyn Fn(D) -&gt; Result&lt;(), PipelineError&gt; + Send+Sync&gt;</code></td>
<td><code>Box&lt;dyn Fn(D) -&gt; Result&lt;(), PipelineError&gt; + Send&gt;</code></td>
<td>Final consumer; returns <code>Result</code> so errors propagate back</td>
</tr>
</tbody>
</table>
<p><code>Pipeline&lt;D&gt;</code> holds one <code>SourceFn</code>, a <code>Vec&lt;SharedFn&gt;</code>, and one <code>SinkFn</code>.<br />
<p>Stages come in two variants:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">enum</span><span class="w"> </span><span class="nc">Stage</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">Transform</span><span class="p">(</span><span class="n">SharedFn</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">),</span><span class="w"> </span><span class="c1">// 1→1</span>
<span class="w"> </span><span class="n">Flat</span><span class="p">(</span><span class="n">SharedFlatFn</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">),</span><span class="w"> </span><span class="c1">// 1→N</span>
<span class="p">}</span>
</code></pre></div>
<p><code>Pipeline&lt;D&gt;</code> holds one <code>SourceFn</code>, a <code>Vec&lt;Stage&gt;</code>, and one <code>SinkFn</code>.<br />
<code>WorkerPool&lt;D&gt;</code> wraps a <code>Pipeline</code> with <code>n_workers</code> and channel <code>capacity</code>.</p>
<h2 id="workerpool">WorkerPool</h2>
<div class="highlight"><pre><span></span><code><span class="n">WorkerPool</span><span class="p">::</span><span class="n">new</span><span class="p">(</span><span class="n">pipeline</span><span class="p">:</span><span class="w"> </span><span class="nc">Pipeline</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="n">n_workers</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">capacity</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">Self</span>
@@ -1193,7 +1310,7 @@
</tr>
<tr>
<td><code>capacity</code></td>
<td>Bound on every crossbeam channel in the pipeline (source output, inter-stage channels, worker input, sink input, sink error). Controls memory and back-pressure: a full channel blocks the sender until a slot frees.</td>
<td>Bound on every crossbeam channel in the pipeline. Controls memory and back-pressure: a full channel blocks the sender until a slot frees.</td>
</tr>
</tbody>
</table>
@@ -1208,7 +1325,7 @@
</code></pre></div>
<p>Each variant carries the concrete type for one stage's output. The macros pattern-match on this enum to route values between stages.</p>
<h2 id="macros">Macros</h2>
<p>Six low-level macros build individual stages; one high-level macro (<code>make_pipeline!</code>) composes them.</p>
<p>Eight low-level macros build individual stages; one high-level macro (<code>make_pipeline!</code>) composes them.</p>
<h3 id="low-level">Low-level</h3>
<div class="highlight"><pre><span></span><code><span class="n">make_source</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields T</span>
<span class="n">make_source_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields Result&lt;T, E&gt;</span>
@@ -1216,6 +1333,9 @@
<span class="n">make_transform</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; U</span>
<span class="n">make_transform_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;U, E&gt;</span>
<span class="n">make_flat_transform</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; impl IntoIterator&lt;Item=U&gt;</span>
<span class="n">make_flat_transform_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;impl IntoIterator&lt;Item=U&gt;, E&gt;</span>
<span class="n">make_sink</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; ()</span>
<span class="n">make_sink_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;(), E&gt;</span>
</code></pre></div>
@@ -1224,17 +1344,31 @@
<div class="highlight"><pre><span></span><code>make_pipeline! {
DataEnum,
source iterator =&gt; OutputVariant, // or source? for fallible
| func: In =&gt; Out, // non-fallible transform
|? func: In =&gt; Out, // fallible transform
| func: In =&gt; Out, // 1→1 non-fallible transform
|? func: In =&gt; Out, // 1→1 fallible transform
|| func: In =&gt; Out, // 1→N non-fallible flat transform
||? func: In =&gt; Out, // 1→N fallible flat transform
sink func @ InputVariant, // or sink? for fallible
}
</code></pre></div>
<p><code>?</code> marks fallibility on source, individual transforms, or sink independently.<br />
Implemented as a <strong>TT muncher</strong>: the internal rule <code>@build</code> recurses over transform tokens one at a time, accumulating them into a <code>vec![]</code>, then terminates on <code>sink</code>/<code>sink?</code>.</p>
<h3 id="make_pipe-dsl">make_pipe! DSL</h3>
<p><code>make_pipe!</code> builds a sourceless/sinkless <code>Pipe&lt;D, In, Out&gt;</code> — a reusable, composable stage sequence:</p>
<div class="highlight"><pre><span></span><code>make_pipe! {
DataEnum : InType =&gt; OutType,
| func: InVariant =&gt; OutVariant,
|? func: InVariant =&gt; OutVariant,
|| func: InVariant =&gt; OutVariant,
||? func: InVariant =&gt; OutVariant,
}
</code></pre></div>
<p>Two pipes compose with <code>.then(other)</code>. Apply to an iterator with <code>.apply(iter, n_workers, capacity)</code> to get a <code>PipeIter&lt;Out&gt;</code> — an iterator over the pipeline output, backed by a background <code>WorkerPool</code>. The scatter step in <code>obikmer</code> uses <code>make_pipe!</code> and <code>.apply()</code> rather than the full <code>make_pipeline!</code> / <code>WorkerPool</code> pattern.</p>
<h2 id="scheduler-architecture">Scheduler architecture</h2>
<div class="highlight"><pre><span></span><code>Source thread ──► [source_rx] ──► Scheduler ──► [worker_tx] ──► Workers (×N)
▲ │
[stage_rxs] ────────┘◄──────────────────────────────┘
[flat_delta_rx] ──► Scheduler (in_flight adjustment)
│
[sink_err_rx] ← errors from sink (highest priority)
│
@@ -1242,20 +1376,20 @@ Implemented as a <strong>TT muncher</strong>: the internal rule <code>@build</co
</code></pre></div>
<p>The scheduler is a single thread running a biased <code>Select</code> over all input channels. Priority order (highest first):</p>
<div class="highlight"><pre><span></span><code>index 0 sink_err_rx abort on sink error
index 1 stage_rxs[N-1] drain last stage first
...
index N stage_rxs[0]
index N+1 source_rx pull new data last
index 1 flat_delta_rx adjust in_flight before dispatching
index 2..=n+1 stage_rxs[n-1..0] drain last stage first
index n+2 source_rx pull new data last
</code></pre></div>
<p>This back-pressure-friendly ordering ensures downstream stages are drained before new items enter the pipeline.</p>
<p><strong>Workers</strong> are generic: each receives <code>(data, SharedFn, result_tx)</code> and calls <code>f(data)</code>, sending the result to the provided channel. The scheduler decides which transform to apply and where to route the result.</p>
<p><strong>Termination</strong> uses an <code>in_flight</code> counter:</p>
<p><strong>Workers</strong> are generic: each receives a <code>WorkerTask</code> — either <code>Transform(data, stage_idx)</code> or <code>Flat(data, stage_idx)</code>. For <code>Transform</code>, the worker calls <code>f(data)</code> and sends the result to <code>stage_txs[stage_idx]</code>. For <code>Flat</code>, the worker calls <code>f(data, &amp;push_tx, &amp;delta_tx)</code>: the closure pushes N items into <code>push_tx</code> then sends <code>N-1</code> to <code>delta_tx</code>. The scheduler uses the delta to adjust <code>in_flight</code> without knowing N in advance.</p>
<p><strong>Termination</strong> uses an <code>in_flight: isize</code> counter and a <code>flat_workers_active: usize</code> counter:</p>
<ul>
<li>incremented when an item is dispatched from source to workers</li>
<li>decremented when the item exits the last stage</li>
<li>the loop exits only when <code>source_done &amp;&amp; in_flight == 0</code></li>
<li><code>in_flight</code> incremented when an item is dispatched from source to workers</li>
<li><code>in_flight</code> decremented when the item exits the last stage to the sink</li>
<li><code>flat_workers_active</code> incremented when a <code>Flat</code> task is dispatched, decremented when the delta arrives</li>
<li>the loop exits only when <code>source_done &amp;&amp; in_flight == 0 &amp;&amp; flat_workers_active == 0</code></li>
</ul>
<p>This guarantees all in-flight items complete before <code>join()</code>.</p>
<p>This guarantees all in-flight items complete (including all N outputs of a flat stage) before <code>join()</code>.</p>
<h2 id="error-handling">Error handling</h2>
<p><code>PipelineError</code> has four variants:</p>
<table>
@@ -1279,7 +1413,7 @@ index N+1 source_rx pull new data last
<td>Internal routing error</td>
</tr>
<tr>
<td><code>StepError(Box&lt;dyn Error&gt;)</code></td>
<td><code>StepError(Box&lt;dyn Error + Send + Sync&gt;)</code></td>
<td>Error from user code (wrapped by <code>make_*_fallible!</code>)</td>
</tr>
</tbody>
File diff suppressed because it is too large Load Diff
@@ -12,7 +12,7 @@
<link rel="prev" href="../persistent_compact_int_vec/">
<link rel="next" href="../../architecture/sequences/invariant/">
<link rel="next" href="../merge/">
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -1002,6 +1030,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
File diff suppressed because it is too large Load Diff
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -985,6 +1013,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
File diff suppressed because it is too large Load Diff
+146 -11
View File
@@ -773,6 +773,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -851,6 +879,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1104,7 +1188,9 @@
<li><strong>error valley</strong> → suggests min_count (typically the local minimum between the error peak and the coverage peak)</li>
</ul>
<h2 id="phase-1-scatter">Phase 1 — Scatter</h2>
<p>Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored. For each read:</p>
<p>Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored.</p>
<p>Input files are read via <code>open_nuc_stream</code>, which opens and decompresses the file, auto-detects the format (FASTA / FASTQ / GenBank), and yields a sequence of <code>NucPage</code> buffers. Each <code>NucPage</code> is a flat 64 KB buffer of normalised bytes (<code>ACGT</code> + <code>\x00</code> separators), carrying a k−1 byte overlap from the preceding page so that no k-mer is lost at page boundaries. Per-record identity (sequence id, raw bytes) is not preserved; this is intentional — the scatter phase only needs normalised bases to produce superkmers.</p>
<p>For each read fragment within a page:</p>
<ol>
<li><strong>Ambiguous base filter</strong>: cut at any non-ACGT base; discard fragments shorter than k.</li>
<li><strong>Entropy filter</strong>: scan each fragment with a sliding window of size k. When the kmer <span class="arithmatex">\(K_i = S[i \mathinner{..} i+k-1]\)</span> ended by nucleotide <span class="arithmatex">\(S[j]\)</span> (with <span class="arithmatex">\(j = i+k-1\)</span>) has entropy below threshold <span class="arithmatex">\(\theta\)</span>, emit the current segment and start a new one (see algorithm below). <span class="arithmatex">\(K_i\)</span> belongs to neither segment, and no valid kmer is lost.</li>
@@ -1154,8 +1240,13 @@ B ≈ 100 is tunable; RAM needed ≈ partition_size / B.</p>
for each kmer in sequence:
kmer_counts[canonical(kmer)] += COUNT
</code></pre></div>
<p>Implemented as an external sort or a temporary HashMap, depending on partition size. At the end of this phase, each distinct canonical kmer has its exact total count.</p>
<p>Abundance filter applied here: kmers with <code>total_count &lt; q</code> are discarded. <code>q</code> is a collection parameter (0 = keep all, including singletons for ≤1x data).</p>
<p>Implemented as a three-step pipeline in <code>count_partition()</code>:</p>
<ol>
<li><strong>External sort</strong> (<code>kmer_sort::sort_unique_kmers</code>): read dereplicated superkmers, extract canonical kmer raw <code>u64</code> values, sort in RAM-bounded chunks (adaptive: 40% of available RAM ÷ n_threads, min 1 M kmers/chunk), k-way merge with inline dedup → <code>sorted_unique.bin</code>. f0 is now known exactly.</li>
<li><strong>Provisional MPHF</strong> (ptr_hash): built from <code>sorted_unique.bin</code> via <code>new_from_par_iter(f0, ...)</code>. Stored to <code>mphf1.bin</code>; <code>sorted_unique.bin</code> deleted immediately.</li>
<li><strong>Accumulation pass</strong>: re-read dereplicated superkmers; for each kmer, <code>slot = mphf.index(kmer.raw())</code>, increment <code>counts1[slot]</code> by the superkmer COUNT. Stored in a <code>PersistentCompactIntVec</code> (<code>counts1.bin</code>).</li>
</ol>
<p>At the end of this phase, each distinct canonical kmer has its exact total count, and the frequency spectrum (<code>spectrums/{label}.json</code>) is written to the index root.</p>
<p>No pre-filter on super-kmer COUNT is possible at phase 2: a super-kmer with COUNT=1 may contain only high-abundance kmers, each present in many other super-kmers across the partition.</p>
<h2 id="phase-4-super-kmer-compaction">Phase 4 — Super-kmer compaction</h2>
<p>The valid kmer set from phase 3 is used as a mask to rewrite the super-kmer files:</p>
@@ -1188,14 +1279,52 @@ branching / dead-end → unitig start or end
<p>Output: <code>unitigs.bin</code> — the permanent evidence structure for the partition. Each kmer in the partition appears at exactly one (unitig_id, offset) location.</p>
<p><strong>Scope of local unitigs:</strong> these are unitigs of the partition's local de Bruijn graph, not global unitigs. A kmer whose k-1 successor or predecessor falls in another partition appears as a dead end locally and terminates the unitig. This does not affect correctness of verification but means partition-local unitigs cannot be directly reused for global assembly.</p>
<h2 id="phase-6-mphf-construction-and-index-finalisation">Phase 6 — MPHF construction and index finalisation</h2>
<p>Built once on the definitive kmer set (all kmers in all unitigs of the partition). See <a href="../obilayeredmap/">obilayeredmap</a> and <a href="../mphf/">MPHF selection</a> for the current implementation.</p>
<div class="highlight"><pre><span></span><code>kmers from unitigs → MPHF → mphf.bin
→ evidence.bin : n × u32, each = (chunk_id: 25 bits | rank: 7 bits)
→ payload : counts/ (mode 2) or presence/ (mode 3)
<p><code>build_index_layer</code> is called per partition (in parallel via <code>build_layers</code>) with the following parameters sourced from <code>IndexConfig</code>:</p>
<ul>
<li><code>block_bits</code> — from <code>IndexConfig::block_bits</code>; controls the <code>.idx</code> block size (2^block_bits unitig chunks per block) for exact evidence</li>
<li><code>evidence</code> — <code>EvidenceKind::Exact</code> or <code>EvidenceKind::Approx { b, z }</code>; propagated unchanged from <code>IndexConfig::evidence</code></li>
<li><code>min_ab</code> / <code>max_ab</code> — abundance bounds applied before graph construction</li>
<li><code>with_counts</code> — whether to store kmer counts alongside set membership</li>
</ul>
<p><strong>Abundance filtering:</strong> when <code>min_ab &gt; 1</code> or <code>max_ab.is_some()</code>, the provisional <code>mphf1.bin</code> and <code>counts1.bin</code> produced in phase 3 are memory-mapped. Each canonical kmer is accepted only if its count in <code>counts1</code> satisfies the bounds. If either file is absent, filtering is skipped (all kmers accepted).</p>
<div class="highlight"><pre><span></span><code>for each kmer in dereplicated super-kmer:
ab = counts1[mphf1.index(kmer.raw())]
if ab &lt; min_ab || ab &gt; max_ab: skip
graph.push(kmer)
</code></pre></div>
<p>The MPHF is built in two passes over <code>unitigs.bin</code>: parallel pass for <code>mphf.bin</code>, sequential pass for <code>evidence.bin</code> and payload. The exact kmer count is available from the unitig index (<code>unitigs.bin.idx</code>) before the passes begin.</p>
<p><strong>Exact verification via unitig evidence:</strong></p>
<p><code>unitigs.bin</code> serves as the evidence structure. The MPHF maps every input to <code>[0, N)</code> including absent kmers — the unitig read-back (via <code>evidence.bin</code>) is the only correct membership test.</p>
<p><strong>Graph build and unitig write:</strong></p>
<p>The surviving kmers are fed into <code>GraphDeBruijn</code>, which computes degrees and yields unitigs. Unitigs are written to <code>layer_0/unitigs.bin</code> via a <code>UnitigFileWriter</code>.</p>
<p><strong>MPHF and evidence build:</strong></p>
<p><code>Layer::build</code> (membership-only) or <code>Layer::&lt;PersistentCompactIntMatrix&gt;::build</code> (with counts) is called next. Internally, <code>MphfLayer::build</code> performs two passes:</p>
<ol>
<li><strong>Pass 1 (parallel):</strong> build <code>unitigs.bin.idx</code> (block size = 2^<code>block_bits</code>) then construct the MPHF from all canonical kmers in <code>unitigs.bin</code>; store to <code>mphf.bin</code>.</li>
<li><strong>Pass 2 (sequential):</strong> for each kmer in <code>unitigs.bin</code>, compute its slot and write <code>evidence.bin</code> (<code>chunk_id: 25 bits | rank: 7 bits</code> packed into a <code>u32</code>); also invoke the payload callback (<code>fill_slot</code>) to populate <code>counts/</code> if <code>with_counts</code>.</li>
</ol>
<p>After <code>Layer::build</code> completes, <code>layer_meta.json</code> records <code>EvidenceKind::Exact</code>.</p>
<p><strong>Approximate evidence override:</strong></p>
<p>If <code>evidence</code> is <code>EvidenceKind::Approx { b, z }</code>, <code>build_approx_evidence</code> is called immediately after <code>Layer::build</code>. It overwrites the exact evidence bundle with <code>fingerprint.bin</code> (b-bit hash per slot) and rewrites <code>layer_meta.json</code> with <code>EvidenceKind::Approx { b, z }</code>. No <code>.idx</code> file is needed at query time in this mode.</p>
<div class="highlight"><pre><span></span><code>// Exact path → evidence.bin + unitigs.bin.idx + layer_meta.json(Exact)
// Approx path → fingerprint.bin + layer_meta.json(Approx{b,z})
// (evidence.bin left on disk but not used)
</code></pre></div>
<p><strong>Partition metadata:</strong></p>
<p>After all layer files are written, <code>PartitionMeta { n_layers: 1 }</code> is serialised to <code>index/meta.json</code> inside the partition directory. This file is required by <code>LayeredMap::open</code> for subsequent merge operations.</p>
<p><strong>File layout per partition after phase 6:</strong></p>
<div class="highlight"><pre><span></span><code>part_XXXXX/
index/
meta.json ← PartitionMeta { n_layers: 1 }
layer_0/
unitigs.bin ← permanent evidence (all modes)
unitigs.bin.idx ← block index (exact mode only)
mphf.bin ← MPHF
evidence.bin ← exact evidence (exact mode)
fingerprint.bin ← b-bit fingerprints (approx mode)
layer_meta.json ← EvidenceKind tag
counts/ ← PersistentCompactIntMatrix (with_counts only)
</code></pre></div>
<p><strong>Cleanup:</strong> unless <code>--keep-intermediate</code> is set, <code>remove_build_artifacts</code> deletes <code>dereplicated.skmer.zst</code>, <code>mphf1.bin</code>, and <code>counts1.bin</code> after all partitions are indexed.</p>
<p>See <a href="../obilayeredmap/">obilayeredmap</a> and <a href="../mphf/">MPHF selection</a> for data structure details.</p>
<p><strong>Query path (exact evidence):</strong></p>
<div class="highlight"><pre><span></span><code>query kmer q
→ canonical_minimizer(q) → hash → PART → part_XXXXX/
→ MPHF(q) → slot s
@@ -1204,7 +1333,13 @@ branching / dead-end → unitig start or end
→ match : return payload[s] ← exact hit
→ no match: kmer absent ← MPHF collision on absent kmer
</code></pre></div>
<p><code>superkmers.bin.gz</code> is no longer needed at this point and can be deleted.</p>
<p><strong>Query path (approximate evidence):</strong></p>
<div class="highlight"><pre><span></span><code>query kmer q
→ MPHF(q) → slot s
→ fingerprint[s] matches seq_hash(q)?
→ yes : probable hit (FP rate = 1/2^b per kmer, 1/2^(b·z) per z-window)
→ no : kmer absent
</code></pre></div>
<div class="footnote">
<hr />
<ol>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+553 -4
View File
@@ -64,7 +64,7 @@
<div data-md-component="skip">
<a href="#on-disk-collection-structure" class="md-skip">
<a href="#on-disk-index-layout" class="md-skip">
Skip to content
</a>
@@ -575,6 +575,24 @@
<label class="md-nav__link md-nav__link--active" for="__toc">
<span class="md-ellipsis">
On-disk storage
</span>
<span class="md-nav__icon md-icon"></span>
</label>
<a href="./" class="md-nav__link md-nav__link--active">
@@ -592,6 +610,174 @@
</a>
<nav class="md-nav md-nav--secondary" aria-label="Table of contents">
<label class="md-nav__title" for="__toc">
<span class="md-nav__icon md-icon"></span>
Table of contents
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#directory-tree" class="md-nav__link">
<span class="md-ellipsis">
Directory tree
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#state-machine-sentinels" class="md-nav__link">
<span class="md-ellipsis">
State machine (sentinels)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#indexmeta-indexmeta" class="md-nav__link">
<span class="md-ellipsis">
index.meta (IndexMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer-files" class="md-nav__link">
<span class="md-ellipsis">
Layer files
</span>
</a>
<nav class="md-nav" aria-label="Layer files">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#unitigsbin" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#unitigsbinidx-exact-only" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin.idx (Exact only)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#mphfbin" class="md-nav__link">
<span class="md-ellipsis">
mphf.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer_metajson-layermeta" class="md-nav__link">
<span class="md-ellipsis">
layer_meta.json (LayerMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidencebin-exact" class="md-nav__link">
<span class="md-ellipsis">
evidence.bin (Exact)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#fingerprintbin-approx" class="md-nav__link">
<span class="md-ellipsis">
fingerprint.bin (Approx)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#counts-persistentcompactintmatrix" class="md-nav__link">
<span class="md-ellipsis">
counts/ (PersistentCompactIntMatrix)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-persistentbitmatrix" class="md-nav__link">
<span class="md-ellipsis">
presence/ (PersistentBitMatrix)
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#metajson-partitionmeta" class="md-nav__link">
<span class="md-ellipsis">
meta.json (PartitionMeta)
</span>
</a>
</li>
</ul>
</nav>
</li>
@@ -659,6 +845,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -737,6 +951,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -874,6 +1144,163 @@
<label class="md-nav__title" for="__toc">
<span class="md-nav__icon md-icon"></span>
Table of contents
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#directory-tree" class="md-nav__link">
<span class="md-ellipsis">
Directory tree
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#state-machine-sentinels" class="md-nav__link">
<span class="md-ellipsis">
State machine (sentinels)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#indexmeta-indexmeta" class="md-nav__link">
<span class="md-ellipsis">
index.meta (IndexMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer-files" class="md-nav__link">
<span class="md-ellipsis">
Layer files
</span>
</a>
<nav class="md-nav" aria-label="Layer files">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#unitigsbin" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#unitigsbinidx-exact-only" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin.idx (Exact only)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#mphfbin" class="md-nav__link">
<span class="md-ellipsis">
mphf.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer_metajson-layermeta" class="md-nav__link">
<span class="md-ellipsis">
layer_meta.json (LayerMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidencebin-exact" class="md-nav__link">
<span class="md-ellipsis">
evidence.bin (Exact)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#fingerprintbin-approx" class="md-nav__link">
<span class="md-ellipsis">
fingerprint.bin (Approx)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#counts-persistentcompactintmatrix" class="md-nav__link">
<span class="md-ellipsis">
counts/ (PersistentCompactIntMatrix)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-persistentbitmatrix" class="md-nav__link">
<span class="md-ellipsis">
presence/ (PersistentBitMatrix)
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#metajson-partitionmeta" class="md-nav__link">
<span class="md-ellipsis">
meta.json (PartitionMeta)
</span>
</a>
</li>
</ul>
</nav>
</div>
</div>
@@ -889,9 +1316,131 @@
<h1 id="on-disk-collection-structure">On-disk collection structure</h1>
<p>See <a href="../obilayeredmap/">obilayeredmap crate</a> for the current on-disk layout.</p>
<p>The index root contains one <code>part_XXXXX/</code> directory per partition, each holding one or more <code>layer_N/</code> directories. Each layer directory contains <code>mphf.bin</code>, <code>unitigs.bin</code>, <code>unitigs.bin.idx</code>, <code>evidence.bin</code>, and optionally a <code>counts/</code> or <code>presence/</code> payload directory.</p>
<h1 id="on-disk-index-layout">On-disk index layout</h1>
<h2 id="directory-tree">Directory tree</h2>
<div class="highlight"><pre><span></span><code>&lt;index_root&gt;/
index.meta ← JSON: IndexMeta
scatter.done ← sentinel: scatter phase complete
count.done ← sentinel: dereplicate + count complete
index.done ← sentinel: MPHF index fully built
spectrums/
&lt;label&gt;.json ← kmer frequency spectrum per genome
partitions/
part_00000/ ← one dir per partition (zero-padded 5 digits, 0..2^n_bits−1)
index/
meta.json ← PartitionMeta { n_layers }
layer_0/
unitigs.bin ← binary unitig sequences (2-bit packed)
unitigs.bin.idx ← block-sampled offset index (exact evidence only)
mphf.bin ← serialised PtrHash MPHF
layer_meta.json ← LayerMeta { evidence: EvidenceKind }
evidence.bin ← chunk_id:rank per MPHF slot (Exact only)
fingerprint.bin ← b-bit fingerprints per MPHF slot (Approx only)
counts/ ← PersistentCompactIntMatrix (if with_counts=true)
presence/ ← PersistentBitMatrix (if presence mode, merge)
layer_1/ ← added by merge; same structure as layer_0
layer_2/ …
part_00001/ …
</code></pre></div>
<h2 id="state-machine-sentinels">State machine (sentinels)</h2>
<p>The sentinels are touched atomically at the end of each pipeline stage.
A partial run (e.g. scatter interrupted) leaves no sentinel; the state is
detected as the lowest sentinel present.</p>
<table>
<thead>
<tr>
<th>State</th>
<th>Sentinel present</th>
<th>Meaning</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>Empty</code></td>
<td>—</td>
<td><code>index.meta</code> exists; scatter not started or interrupted</td>
</tr>
<tr>
<td><code>Scattered</code></td>
<td><code>scatter.done</code></td>
<td>All super-kmers routed to partition files</td>
</tr>
<tr>
<td><code>Counted</code></td>
<td><code>count.done</code></td>
<td>Partitions dereplicated; <code>spectrums/</code> written</td>
</tr>
<tr>
<td><code>Indexed</code></td>
<td><code>index.done</code></td>
<td>All MPHF layers built; index ready for queries</td>
</tr>
</tbody>
</table>
<h2 id="indexmeta-indexmeta">index.meta (IndexMeta)</h2>
<div class="highlight"><pre><span></span><code><span class="p">{</span>
<span class="w"> </span><span class="nt">&quot;version&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">1</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;config&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="nt">&quot;kmer_size&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">31</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;minimizer_size&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">11</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;n_bits&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">8</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;with_counts&quot;</span><span class="p">:</span><span class="w"> </span><span class="kc">false</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;Exact&quot;</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;block_bits&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">0</span>
<span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="nt">&quot;genomes&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">[</span>
<span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;label&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;genome_A&quot;</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;meta&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;species&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;Homo sapiens&quot;</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
<span class="w"> </span><span class="p">]</span>
<span class="p">}</span>
</code></pre></div>
<p><code>n_bits</code> determines the partition count: <code>2^n_bits</code> directories under <code>partitions/</code>.</p>
<p><code>evidence</code> is either the string <code>"Exact"</code> or <code>{"Approx": {"b": 8, "z": 1}}</code>.</p>
<p><code>block_bits</code> controls the <code>.idx</code> granularity: one offset entry every <code>2^block_bits</code>
chunks. <code>block_bits=0</code> stores one entry per chunk (O(1) random access, largest <code>.idx</code>).</p>
<p><code>GenomeInfo.meta</code> is a free-form string→string map for categorical metadata (e.g.
taxonomy, sample origin). It is optional; defaults to empty.</p>
<h2 id="layer-files">Layer files</h2>
<h3 id="unitigsbin">unitigs.bin</h3>
<p>2-bit packed binary unitig sequences. Each record: 1 byte <code>seql_minus_k</code>
(nucleotide length − k), followed by <code>ceil((seql_minus_k + k) / 4)</code> bytes of
packed sequence. Long unitigs are transparently split into overlapping chunks
(k−1 nucleotide overlap) so no k-mer crosses a chunk boundary.</p>
<h3 id="unitigsbinidx-exact-only">unitigs.bin.idx (Exact only)</h3>
<p>Magic <code>UIX3</code>, little-endian header: <code>block_bits</code> (u32), <code>n_unitigs</code> (u32),
<code>n_kmers</code> (u64), then <code>ceil(n_unitigs / 2^block_bits) + 1</code> byte-offset entries
(u32 each, last entry is a sentinel past-end offset). Absent for Approx layers.</p>
<h3 id="mphfbin">mphf.bin</h3>
<p>PtrHash MPHF serialised with epserde. Maps canonical kmer (u64, left-aligned
2-bit) to a slot index in <code>[0, n_kmers)</code>.</p>
<h3 id="layer_metajson-layermeta">layer_meta.json (LayerMeta)</h3>
<p><div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;type&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;exact&quot;</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
</code></pre></div>
or
<div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;type&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;approx&quot;</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;b&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">8</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;z&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
</code></pre></div></p>
<h3 id="evidencebin-exact">evidence.bin (Exact)</h3>
<p>One <code>(chunk_id: u32, rank: u8)</code> record per MPHF slot, packed. Used to verify
that the kmer mapped to a slot is actually present: <code>unitigs.bin[chunk_id][rank]</code>
is re-read and compared against the query.</p>
<h3 id="fingerprintbin-approx">fingerprint.bin (Approx)</h3>
<p><code>b</code>-bit fingerprint per MPHF slot derived from the kmer's sequence hash.
False-positive rate per query ≈ <code>1/2^b</code>. With Findere parameter <code>z ≥ 2</code>,
<code>z</code> consecutive k-mers must all match, reducing the effective FP rate to
approximately <code>W / 2^(b·z)</code> per read of length <code>L</code>
(where <code>W = L − k − z + 2</code>).</p>
<h3 id="counts-persistentcompactintmatrix">counts/ (PersistentCompactIntMatrix)</h3>
<p>Present when <code>with_counts=true</code>. One column per genome; each row holds the
per-genome k-mer count for the corresponding MPHF slot. Appended column-by-column
during indexing and merge.</p>
<h3 id="presence-persistentbitmatrix">presence/ (PersistentBitMatrix)</h3>
<p>Present when the layer was built in presence/absence mode (merge path).
One bit per genome per MPHF slot. Written during merge; never present on a
freshly indexed single-genome layer.</p>
<h2 id="metajson-partitionmeta">meta.json (PartitionMeta)</h2>
<div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;n_layers&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="p">}</span>
</code></pre></div>
<p>Records how many <code>layer_N/</code> directories exist under <code>index/</code>. Incremented by
each merge that adds a layer.</p>
File diff suppressed because it is too large Load Diff
+125 -58
View File
@@ -751,6 +751,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link">
@@ -829,6 +857,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1046,61 +1130,49 @@
<h1 id="superkmer-implementation">SuperKmer — implementation</h1>
<h2 id="memory-layout">Memory layout</h2>
<p>A super-kmer is stored as a <strong>32-bit header</strong> followed by a <strong>byte-aligned nucleotide sequence</strong> (2 bits/base, nucleotide 0 at the MSB of the first byte):</p>
<p><code>SuperKmer</code> holds two separate fields:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">SuperKmer</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="n">count</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">,</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="n">inner</span><span class="p">:</span><span class="w"> </span><span class="nc">PackedSeq</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p><code>PackedSeq</code> stores a 2-bit packed DNA sequence as a heap-allocated <code>Box&lt;[u8]&gt;</code> plus a <code>tail: u8</code> field:</p>
<table>
<thead>
<tr>
<th>Field</th>
<th>Bits</th>
<th>Type</th>
<th>Role</th>
</tr>
</thead>
<tbody>
<tr>
<td>COUNT</td>
<td>24</td>
<td>Occurrence count (≤ 16 M)</td>
<td><code>tail</code></td>
<td><code>u8</code></td>
<td>Number of valid nucleotides in the last byte: 0 encodes 4, 1–3 are identity</td>
</tr>
<tr>
<td>NKMERS</td>
<td>8</td>
<td>Number of kmers (= seq_length − k + 1, range 1–255)</td>
<td><code>seq</code></td>
<td><code>Box&lt;[u8]&gt;</code></td>
<td>2-bit packed bytes, nucleotide 0 at bits 7–6 of <code>seq[0]</code></td>
</tr>
</tbody>
</table>
<p>Bit layout (MSB to LSB): <code>[31:8] COUNT [7:0] NKMERS</code></p>
<p>NKMERS is stored as a raw <code>u8</code> in <strong>kmer units</strong>, not nucleotides. The nucleotide length is recovered as <code>NKMERS + k − 1</code>. This avoids the awkward wrapping convention (<code>0 = 256</code>) that would be needed if nucleotide length were stored directly, and gains k−1 = 30 units of headroom:</p>
<table>
<thead>
<tr>
<th>unit</th>
<th>u8 covers</th>
<th>max nucleotides</th>
</tr>
</thead>
<tbody>
<tr>
<td>nucleotides</td>
<td>255 nt</td>
<td>225 kmers</td>
</tr>
<tr>
<td><strong>kmers</strong></td>
<td><strong>255 kmers</strong></td>
<td><strong>285 nt</strong></td>
</tr>
</tbody>
</table>
<p>The public accessors:</p>
<div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">n_kmers</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="p">(</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0xFF</span><span class="p">)</span><span class="w"> </span><span class="k">as</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">seql</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">n_kmers</span><span class="p">()</span><span class="w"> </span><span class="o">+</span><span class="w"> </span><span class="n">K</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">count</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">8</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">increment</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">add</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="n">n</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">set_count</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">(</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0xFF</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">(</span><span class="n">n</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">);</span><span class="w"> </span><span class="p">}</span>
<p>Nucleotide length is recovered without storing it explicitly:</p>
<div class="highlight"><pre><span></span><code>seql = (seq.len() - 1) * 4 + tail_count(tail)
</code></pre></div>
<p>There is no packed header word — <code>count</code> and the sequence live in separate fields.</p>
<p>The on-disk binary format (produced by <code>write_to_binary</code>) is:</p>
<div class="highlight"><pre><span></span><code>[varint(count)] [u8: seql − k] [packed bytes…]
</code></pre></div>
<p><code>seql − k</code> fits in a <code>u8</code> when <code>n_kmers = seql − k + 1 ≤ MAX_KMERS_PER_CHUNK (= 256)</code>. If a super-kmer exceeds 256 kmers, <code>write_to_binary</code> splits it into overlapping chunks (k−1 nucleotide overlap, same count per chunk), each a self-contained record readable by <code>read_from_binary</code>.</p>
<p>The public accessors operate on the struct fields directly:</p>
<div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">seql</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">inner</span><span class="p">.</span><span class="n">seql</span><span class="p">()</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">count</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">increment</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="mi">1</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">add</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="n">n</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">set_count</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">n</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
</code></pre></div>
<p>In practice, observed super-kmer lengths on metagenomic data (k=31) are below 55 nucleotides (≤ 25 kmers) — far from the 255-kmer cap. If a super-kmer ever exceeds 255 kmers, it is split with a k−1 nucleotide overlap, preserving all kmers without duplication (identical mechanism to partition-boundary splits).</p>
<p>The sequence is always stored in canonical form (lexicographic minimum of forward and reverse complement), with nucleotide 0 at the MSB of the first byte. The byte array can be hashed directly without any adjustment.</p>
<h2 id="ascii-encoding-and-decoding">ASCII encoding and decoding</h2>
<p>Two lookup tables handle ASCII ↔ 2-bit conversion:</p>
<ul>
@@ -1125,7 +1197,7 @@
</code></pre></div>
<p><code>REVCOMP4</code> is 256 bytes (fits in L1 cache), computed at compile time. No endianness dependency — all operations are pure arithmetic on byte values.</p>
<p><strong>Step 2 — realignment.</strong> After step 1, <code>padding = n × 8 − seql × 2</code> spurious bits (complements of the original padding A's) appear at the start of the array. They are flushed left using <code>BitSlice&lt;u8, Msb0&gt;::rotate_left(padding)</code> from the <code>bitvec</code> crate, which is SIMD-accelerated. The trailing <code>padding</code> bits are then zeroed:</p>
<div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">n_kmers</span><span class="p">()</span><span class="w"> </span><span class="o">+</span><span class="w"> </span><span class="n">k</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">1</span><span class="p">;</span>
<div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">seql</span><span class="p">();</span>
<span class="n">shift</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">n</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">8</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="c1">// number of padding bits</span>
<span class="n">bits</span><span class="p">.</span><span class="n">rotate_left</span><span class="p">(</span><span class="n">shift</span><span class="p">)</span>
<span class="n">bits</span><span class="p">[</span><span class="n">len</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">shift</span><span class="o">..</span><span class="p">].</span><span class="n">fill</span><span class="p">(</span><span class="kc">false</span><span class="p">)</span>
@@ -1143,7 +1215,7 @@
</code></pre></div>
</div>
<h2 id="minimizer-sliding-window">Minimizer sliding window</h2>
<p>Super-kmers are built by <code>SuperKmerIter</code> (crate <code>obiskbuilder</code>), which maintains the current minimizer with a <strong>monotonic deque</strong> over a sliding window of W = k − m + 1 m-mer positions.</p>
<p>Super-kmers are built by <code>SuperKmerIter</code> (crate <code>obiskbuilder</code>), which tracks the current minimizer with a <strong>monotonic deque</strong> (<code>Ring&lt;MmerItem, 32&gt;</code>) inside <code>RollingStat</code>, a rolling-window entropy and minimizer tracker.</p>
<p>Each deque entry stores:</p>
<table>
<thead>
@@ -1167,20 +1239,11 @@
<tr>
<td><code>hash</code></td>
<td>u64</td>
<td><span class="arithmatex">\(H(\text{canonical})\)</span> — ordering key for random minimizer selection</td>
<td><code>hash_kmer(canonical &lt;&lt; (64 − 2m))</code> — ordering key for random minimizer selection</td>
</tr>
</tbody>
</table>
<p>The hash <span class="arithmatex">\(H\)</span> is the seeded splitmix64 finalizer (see <a href="../../theory/minimizer/">Minimizer selection</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">hash_mmer</span><span class="p">(</span><span class="n">canonical</span><span class="p">:</span><span class="w"> </span><span class="kt">u64</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u64</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">canonical</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="mh">0x9e3779b97f4a7c15</span><span class="p">;</span><span class="w"> </span><span class="c1">// seed: eliminates fixed point at 0</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">30</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">wrapping_mul</span><span class="p">(</span><span class="mh">0xbf58476d1ce4e5b9</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">27</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">wrapping_mul</span><span class="p">(</span><span class="mh">0x94d049bb133111eb</span><span class="p">);</span>
<span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">31</span><span class="p">)</span>
<span class="p">}</span>
</code></pre></div>
<p>The hash uses the seeded splitmix64 finalizer (<code>mix64(raw ^ 0x9e3779b97f4a7c15)</code>), the same function as <code>kmer::hash_kmer</code>.</p>
<p>On each new nucleotide, once the window is full, the deque is updated:</p>
<div class="admonition abstract">
<p class="admonition-title">Algorithm — minimizer deque update</p>
@@ -1196,17 +1259,21 @@
</code></pre></div>
</div>
<p>The front of the deque is always the current minimizer. Because the deque is maintained in strictly increasing hash order, each entry is popped at most once — O(1) amortized per nucleotide.</p>
<p>A super-kmer boundary is emitted when the minimizer changes: <code>deque.front.hash ≠ prev_hash</code>. The <code>canonical</code> field of the front entry is <strong>not</strong> used for boundary detection — that uses the hash alone. The canonical value is stored so that the partition key <span class="arithmatex">\(H(\text{canonical})\)</span> can be recomputed independently at routing time from the stored <code>minimizer_pos</code>, without inheriting the minimum-order-statistic bias (see <a href="../../theory/minimizer/#partition-key-independence">Minimizer selection — partition key independence</a>).</p>
<p>A super-kmer boundary is emitted when the minimizer changes: <code>current_minimizer != prev_minimizer</code>. <code>SuperKmerIter</code> also emits a boundary when:</p>
<ul>
<li>entropy of the current k-mer falls at or below the threshold θ (cursor retreated by k−1)</li>
<li>super-kmer length reaches 256 nucleotides (cursor retreated by k)</li>
</ul>
<h2 id="kmer-extraction">Kmer extraction</h2>
<p>A k-mer is extracted from a super-kmer with <code>SuperKmer::kmer(i, k)</code>, which returns a <code>Kmer</code> — a left-aligned <code>u64</code> newtype (see <a href="../kmer/">Kmer implementation</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">kmer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">k</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Kmer</span><span class="p">,</span><span class="w"> </span><span class="n">KmerError</span><span class="o">&gt;</span>
<p>A k-mer is extracted from a super-kmer with <code>SuperKmer::kmer(i)</code>, which delegates to <code>PackedSeq::extract::&lt;KLen&gt;(i)</code> and returns a <code>Kmer</code> — a left-aligned <code>u64</code> newtype (see <a href="../kmer/">Kmer implementation</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">kmer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Kmer</span><span class="p">,</span><span class="w"> </span><span class="n">KmerError</span><span class="o">&gt;</span>
</code></pre></div>
<p>The bit slice <code>seq[i*2 .. (i+k)*2]</code> (Msb0 order) is loaded as a big-endian <code>u64</code> via <code>bitvec::load_be</code>, then left-shifted to produce the canonical left-aligned layout. One call — no loop, no allocation.</p>
<p>The bit slice <code>seq[i*2 .. (i+k)*2]</code> (Msb0 order) is loaded as a <code>u64</code> via <code>bitvec::load_be</code>, then left-shifted to produce the canonical left-aligned layout. One call — no loop, no allocation.</p>
<hr />
<div class="admonition abstract">
<p class="admonition-title">Algorithm — Super-kmer reverse complement</p>
<div class="highlight"><pre><span></span><code>procedure SuperKmerRevcomp(seq, SEQL):
seql ← NKMERS + k − 1 -- nucleotide length
seql ← nucleotide length
n ← ⌈seql / 4⌉ -- number of bytes
shift ← n × 8 − seql × 2 -- padding bits to flush
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+294 -1
View File
@@ -213,6 +213,17 @@
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#subcommands" class="md-nav__link">
<span class="md-ellipsis">
Subcommands
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#constraints" class="md-nav__link">
<span class="md-ellipsis">
@@ -222,6 +233,28 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#parameter-constraints-enforced-at-cli" class="md-nav__link">
<span class="md-ellipsis">
Parameter constraints (enforced at CLI)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#genome-label-constraints" class="md-nav__link">
<span class="md-ellipsis">
Genome label constraints
</span>
</a>
</li>
<li class="md-nav__item">
@@ -714,6 +747,34 @@
<li class="md-nav__item">
<a href="implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="implementation/obilayeredmap/" class="md-nav__link">
@@ -792,6 +853,62 @@
<li class="md-nav__item">
<a href="implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -935,6 +1052,17 @@
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#subcommands" class="md-nav__link">
<span class="md-ellipsis">
Subcommands
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#constraints" class="md-nav__link">
<span class="md-ellipsis">
@@ -944,6 +1072,28 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#parameter-constraints-enforced-at-cli" class="md-nav__link">
<span class="md-ellipsis">
Parameter constraints (enforced at CLI)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#genome-label-constraints" class="md-nav__link">
<span class="md-ellipsis">
Genome label constraints
</span>
</a>
</li>
<li class="md-nav__item">
@@ -976,12 +1126,155 @@
<h1 id="obikmer">obikmer</h1>
<p><code>obikmer</code> is a Rust tool for manipulation, counting, indexing, and set operations on DNA sequences represented as kmer sets.</p>
<h2 id="subcommands">Subcommands</h2>
<table>
<thead>
<tr>
<th>Subcommand</th>
<th>Purpose</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>superkmer</code></td>
<td>Extract super-kmers from a sequence file and write to stdout</td>
</tr>
<tr>
<td><code>index</code></td>
<td>Build a complete genome index (scatter → dereplicate → count → layered MPHF)</td>
</tr>
<tr>
<td><code>merge</code></td>
<td>Merge multiple built indexes into one</td>
</tr>
<tr>
<td><code>rebuild</code></td>
<td>Filter and compact an existing index into a new single-layer index; supports ingroup/outgroup predicates on genome metadata</td>
</tr>
<tr>
<td><code>query</code></td>
<td>Query an index with sequences and annotate matches</td>
</tr>
<tr>
<td><code>dump</code></td>
<td>Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the same ingroup/outgroup filtering as <code>rebuild</code></td>
</tr>
<tr>
<td><code>annotate</code></td>
<td>Add or update genome metadata from a CSV file; or dump metadata as CSV</td>
</tr>
<tr>
<td><code>distance</code></td>
<td>Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees</td>
</tr>
<tr>
<td><code>unitig</code></td>
<td>Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the same ingroup/outgroup filtering as <code>rebuild</code></td>
</tr>
<tr>
<td><code>estimate</code></td>
<td>Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing</td>
</tr>
<tr>
<td><code>reindex</code></td>
<td>Convert an index's evidence in-place: exact ↔ approx</td>
</tr>
<tr>
<td><code>utils</code></td>
<td>Miscellaneous index utilities: <code>--new-label NEW=OLD</code> renames a genome label; <code>--upgrade-index</code> adds missing <code>layer_meta.json</code> to old indexes</td>
</tr>
<tr>
<td><code>pack</code></td>
<td>Pack per-column matrix files into single-file format to reduce query I/O</td>
</tr>
</tbody>
</table>
<h2 id="constraints">Constraints</h2>
<ul>
<li>Target scale: individual genome datasets, tens of Gbases</li>
<li>Maximum efficiency in computation, memory, and disk usage</li>
<li>Input formats: FASTA, FASTQ, gzip, streaming stdin</li>
<li>k odd, k ∈ [11, 31], fixed at runtime; kmer fits in a u64 (2 bits/base)</li>
<li>Canonical form: <code>min(kmer, revcomp(kmer))</code> reduces strand-symmetric space by half</li>
<li>Input formats for <code>index</code>/<code>superkmer</code>: FASTA (<code>.fa</code>, <code>.fasta</code>), FASTQ (<code>.fq</code>, <code>.fastq</code>), GenBank flat file (<code>.gb</code>, <code>.gbk</code>, <code>.gbff</code>), all optionally gzip-compressed; directories expanded recursively; streaming stdin via <code>-</code></li>
<li>Input formats for <code>query</code>: FASTA, FASTQ, optionally gzip-compressed; streaming stdin via <code>-</code></li>
</ul>
<h2 id="parameter-constraints-enforced-at-cli">Parameter constraints (enforced at CLI)</h2>
<p>All constraints below are checked by <code>CommonArgs::validate()</code> at the start of <code>superkmer</code> and <code>index</code>. Invalid values exit immediately with an error.</p>
<table>
<thead>
<tr>
<th>Parameter</th>
<th>Constraint</th>
<th>Reason</th>
</tr>
</thead>
<tbody>
<tr>
<td>k (<code>--kmer-size</code>)</td>
<td>odd</td>
<td>even k allows palindromic k-mers: kmer == revcomp(kmer), breaking the canonical form invariant</td>
</tr>
<tr>
<td>k (<code>--kmer-size</code>)</td>
<td>k ∈ [11, 31]</td>
<td>k &gt; 31 overflows u64 at 2 bits/base; k &lt; 11 gives insufficient specificity</td>
</tr>
<tr>
<td>m (<code>--minimizer-size</code>)</td>
<td>odd</td>
<td>same palindrome argument as k</td>
</tr>
<tr>
<td>m (<code>--minimizer-size</code>)</td>
<td>3 ≤ m ≤ k−1</td>
<td>minimizer must be strictly shorter than the kmer</td>
</tr>
<tr>
<td>z (<code>-z</code>, Findere, <code>index --approx</code> only)</td>
<td>z ≤ k−1</td>
<td>effective indexed kmer size is k−z+1; z ≥ k would make it ≤ 0</td>
</tr>
</tbody>
</table>
<h2 id="genome-label-constraints">Genome label constraints</h2>
<p>Genome labels are arbitrary Unicode strings with the following restrictions:</p>
<table>
<thead>
<tr>
<th>Character</th>
<th>Forbidden</th>
<th>Reason</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>/</code></td>
<td>yes</td>
<td>filesystem path separator</td>
</tr>
<tr>
<td><code>=</code></td>
<td>yes</td>
<td><code>--new-label</code> parser separator</td>
</tr>
<tr>
<td><code>\0</code></td>
<td>yes</td>
<td>null byte</td>
</tr>
<tr>
<td><code>\n</code> <code>\r</code> <code>\t</code></td>
<td>yes</td>
<td>break CSV output</td>
</tr>
<tr>
<td>spaces</td>
<td><strong>allowed</strong></td>
<td>use shell quoting: <code>--new-label 'new label=old label'</code></td>
</tr>
</tbody>
</table>
<p>Empty labels are also rejected. Labels derived automatically from the index directory name (when <code>--label</code> is omitted) are not validated since they come from the filesystem and are already safe.</p>
<h2 id="priority-operations">Priority operations</h2>
<ul>
<li>Kmer counting (frequencies)</li>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+87 -2
View File
@@ -746,6 +746,34 @@
<li class="md-nav__item">
<a href="../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../implementation/obilayeredmap/" class="md-nav__link">
@@ -824,6 +852,62 @@
<li class="md-nav__item">
<a href="../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1038,11 +1122,12 @@
<h2 id="kmers">Kmers</h2>
<p>A <strong>kmer</strong> is a DNA subsequence of fixed length k. Two constraints govern the choice of k:</p>
<ul>
<li><strong>k ∈ [11, 31]</strong>: the range ensures the kmer is long enough to be specific and short enough to fit in a single machine word.</li>
<li><strong>k ∈ [11, 31]</strong>: the range ensures the kmer is long enough to be specific and short enough to fit in a single machine word (u64 at 2 bits/base requires k ≤ 32; k &lt; 11 yields insufficient specificity).</li>
<li><strong>k is odd</strong>: an odd-length sequence cannot equal its own reverse complement (no palindromes). This guarantees that the canonical form <code>min(kmer, revcomp(kmer))</code> is always strictly defined — the two orientations are always distinct — which is required for strand-independent counting.</li>
</ul>
<p>Both constraints are <strong>enforced at CLI entry</strong> by <code>CommonArgs::validate()</code> in <code>superkmer</code> and <code>index</code>. Passing an invalid k exits immediately with an error message.</p>
<h2 id="super-kmers">Super-kmers</h2>
<p>A <strong>super-kmer</strong> is a maximal run of consecutive kmers from a DNA read, each overlapping the next by k−1 nucleotides. Each kmer of the run carries the same <strong>canonical minimizer</strong>. The <strong>canonical minimizer</strong> of a kmer is the smallest value of <code>min(m-mer, revcomp(m-mer))</code> over all m-mers within the kmer (m &lt; k, m odd), with the constraint that <strong>non-degenerate m-mers are always preferred</strong> over degenerate ones. A degenerate m-mer is one composed of a single repeated nucleotide (all-A, all-C, all-G, or all-T); such m-mers are selected only if no non-degenerate candidate exists in the window.</p>
<p>A <strong>super-kmer</strong> is a maximal run of consecutive kmers from a DNA read, each overlapping the next by k−1 nucleotides, sharing the same <strong>canonical minimizer</strong>. The <strong>canonical minimizer</strong> of a kmer is the m-mer (m &lt; k) whose canonical hash <code>hash_kmer(min(m-mer, revcomp(m-mer)))</code> is smallest over all m-mers in the kmer window. The hash function is a <code>mix64</code>-based bijection; selection is purely hash-ordered with no degeneracy filter. A super-kmer is capped at 256 nucleotides; a longer run is split at that boundary.</p>
<h3 id="canonical-super-kmers">Canonical super-kmers</h3>
<p>A <strong>canonical super-kmer</strong> is the lexicographic minimum of a super-kmer and its reverse complement:</p>
<div class="highlight"><pre><span></span><code>canonical(super-kmer) = min(super-kmer, revcomp(super-kmer))
Binary file not shown.
File diff suppressed because it is too large Load Diff
+93 -6
View File
@@ -718,6 +718,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -796,6 +824,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1010,17 +1094,20 @@
<p>The Watson-Crick complement of any base is its bitwise NOT on 2 bits: <code>complement(base) = ~base &amp; 0b11</code>.</p>
<h2 id="kmer-encoding">Kmer encoding</h2>
<p>A kmer fits in a single <code>u64</code>. Nucleotide 0 occupies bits 63–62, nucleotide i occupies bits 63−2i and 62−2i, and the low 64−2k bits are zero. Extraction of nucleotide i (0 ≤ i &lt; k): <code>(kmer &gt;&gt; (62 - 2*i)) &amp; 0b11</code>.</p>
<p>Reverse complement is computed via a <strong>16-bit lookup table</strong> (65 536 entries × 2 bytes = 128 KB, fits in L2 cache) storing the reverse-complement of every 8-base chunk.</p>
<p>Reverse complement is computed by <strong>bit manipulation in four steps</strong>, with no lookup table:</p>
<div class="admonition abstract">
<p class="admonition-title">Algorithm — Kmer reverse complement</p>
<div class="highlight"><pre><span></span><code>procedure KmerRevcomp(kmer, k):
raw ← TABLE16[kmer &amp; 0xFFFF] &lt;&lt; 48
| TABLE16[(kmer &gt;&gt; 16) &amp; 0xFFFF] &lt;&lt; 32
| TABLE16[(kmer &gt;&gt; 32) &amp; 0xFFFF] &lt;&lt; 16
| TABLE16[(kmer &gt;&gt; 48) &amp; 0xFFFF]
return raw &lt;&lt; (64 - 2*k)
x ← ~kmer -- complement all bases
x ← swap_bytes(x) -- reverse byte order
x ← ((x &gt;&gt; 4) &amp; 0x0F0F0F0F0F0F0F0F)
| ((x &amp; 0x0F0F0F0F0F0F0F0F) &lt;&lt; 4) -- swap nibbles within each byte
x ← ((x &gt;&gt; 2) &amp; 0x3333333333333333)
| ((x &amp; 0x3333333333333333) &lt;&lt; 2) -- swap 2-bit pairs within each nibble
return x &lt;&lt; (64 - 2*k) -- re-align to MSB
</code></pre></div>
</div>
<p>The three reorder passes together reverse the order of all 2-bit base codes across the 64-bit word. The bitwise NOT in the first step complements each base (A↔T, C↔G). The final left shift clears the low 64−2k padding bits.</p>
<p>The <strong>canonical form</strong> is the lexicographic minimum of the kmer and its reverse complement:</p>
<div class="highlight"><pre><span></span><code>canonical(kmer) = min(kmer, revcomp(kmer))
</code></pre></div>
File diff suppressed because it is too large Load Diff
+85 -1
View File
@@ -773,6 +773,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -851,6 +879,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
@@ -1109,7 +1193,7 @@
<h2 id="final-score">Final score</h2>
<p>The filter computes <span class="arithmatex">\(\hat{H}(ws)\)</span> for each word size ws from 1 to ws_max and returns the <strong>minimum</strong>:</p>
<div class="arithmatex">\[\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)\]</div>
<p>A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if <span class="arithmatex">\(\text{entropy}(kmer) \leq \theta\)</span>, where <span class="arithmatex">\(\theta\)</span> is a collection parameter. The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.</p>
<p>A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if <span class="arithmatex">\(\text{entropy}(kmer) &lt; \theta\)</span>, where <span class="arithmatex">\(\theta\)</span> is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.</p>
<h2 id="interpretation-as-an-effective-number-of-classes">Interpretation as an effective number of classes</h2>
<p><span class="arithmatex">\(H_{\text{corr}}\)</span> is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: <span class="arithmatex">\(N_{\text{eff}} = e^{H_{\text{corr}}}\)</span> is the number of equiprobable classes that would yield the same entropy.</p>
<p>For the normalised score <span class="arithmatex">\(\hat{H}\)</span>, dividing by <span class="arithmatex">\(H_{\text{max}}\)</span> changes the logarithm base:</p>
File diff suppressed because it is too large Load Diff
+84
View File
@@ -718,6 +718,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -796,6 +824,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
File diff suppressed because it is too large Load Diff
+84
View File
@@ -762,6 +762,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -840,6 +868,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul>
</nav>
+323
View File
@@ -0,0 +1,323 @@
# NUMA-aware partition runner
## Problem
All partition-level parallel loops in obikindex currently fall into two
categories:
**Naive Rayon** — used in `build_layers`, `pack_matrices`, `dump`, `select`,
`stats`, `rebuild`, `reindex`:
```rust
(0..n).into_par_iter().for_each(|i| work(i));
```
Threads come from the global Rayon pool with no NUMA awareness. On
multi-socket machines this produces cross-socket memory traffic and degrades
performance super-linearly (see [NUMA-aware worker pools](numa_worker_pools.md)).
**Ad-hoc adaptive pool** — used in `merge`:
A bespoke implementation with pre-spawned workers, channel-based dispatch, and
activation control. It handles NUMA correctly but is not reusable.
Both cases should be replaced by a single generic mechanism.
## Unified model
The key insight is that **UMA is just the NUMA case with a single node**. The
runner always works the same way: one controller thread per node, each
independently managing its own workers with the same adaptive logic. The only
difference between UMA and NUMA is the number of nodes and whether workers are
pinned.
```
NUMA (k nodes) UMA (1 node)
controller-0 controller-1 … controller-0
│ │ │
workers[0] workers[1] workers[0]
(pinned) (pinned) (global pool)
└───────────────┴──────────────────┘
shared work queue
```
On each node, the Rayon `ThreadPool` is pinned to that node's CPUs.
`pool.install()` ensures all internal Rayon calls (inside the work function)
use the node-local pool. Linux first-touch then places heap allocations in
local DRAM automatically.
On UMA the global Rayon pool is used directly — no pinning, no overhead.
## Adaptive mechanism
Each controller follows the same logic regardless of node count:
1. Pre-spawn `workers_per_node` dormant worker threads (blocked on `activate_rx`).
2. Activate the first worker immediately.
3. Loop on result channel with a `SPAWN_POLL` timeout:
- On result: call `on_done`; check whether to activate the next worker.
- On timeout: same check.
- Activation criterion: `should_spawn_worker(active, global_efficiency, prev_efficiency)`.
4. Drop `activate_tx` when done — dormant workers exit cleanly.
**Global CPU efficiency** (`CpuSample`, reads `/proc/stat` on Linux) is used by
all controllers — no per-node measurement needed. The signal is coarser than
per-node efficiency but correct in practice: if any node saturates memory
bandwidth, the global efficiency drops and all controllers stop activating
workers. Using a standard portable primitive avoids platform-specific CPU
accounting and keeps the implementation clean.
## Proposed API
```rust
pub struct PartitionRunner {
// One entry per NUMA node; one entry total on UMA.
nodes: Vec<NodeConfig>,
}
struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>, // None = global Rayon pool (UMA)
cpu_ids: Vec<usize>, // empty = no pinning (UMA)
max_workers: usize,
}
impl PartitionRunner {
/// Detect topology and build the runner.
/// Returns a single-node runner on UMA / macOS / hwloc failure.
pub fn new() -> Self;
/// Run `f(i)` for every index in `order`, collecting results.
///
/// `on_done(i, result, elapsed)` is called under an internal mutex as
/// each partition completes — use it for progress bars and aggregation.
/// The runner serialises all calls to `on_done` via an internal
/// `Arc<Mutex<C>>`, so no `Sync` bound is required on the callback.
/// `Send` is required because the Arc clone crosses thread boundaries.
///
/// Serialisation is free in practice: a partition takes seconds to
/// minutes; the callback takes microseconds. Contention is negligible.
///
/// Returns the first error from `f`, if any.
pub fn run<F, R, E, C>(
&self,
order: &[usize],
f: F,
on_done: C,
) -> Result<(), E>
where
F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send,
E: Send,
C: FnMut(usize, R, Duration) + Send; // Send required, Sync is not
}
```
`order` is caller-supplied so each command chooses its scheduling strategy:
largest-first for `merge`, sequential for `build_layers`, etc.
## Migration examples
### merge.rs (before: ~180 lines of bespoke machinery)
```rust
let runner = PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
.map_err(OKIError::Partition),
|i, g_len, dur| {
pb.inc(1);
debug!("partition {i}: done in {:.1}s — {g_len} new kmers", dur.as_secs_f64());
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
},
)?;
```
### index.rs build_layers (before: naive into_par_iter)
```rust
let order: Vec<usize> = (0..n).collect();
let runner = PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits)
.map_err(OKIError::Partition),
|_, n_kmers, _| {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
pb.inc(1);
},
)?;
```
All other sites (`pack_matrices`, `dump`, `select`, etc.) follow the same
pattern.
## Placement
`PartitionRunner` lives in `obikindex/src/numa.rs` alongside `NumaSetup`.
It depends only on standard library primitives and Rayon — no new dependencies.
A single `PartitionRunner` instance can be built once per command invocation
and reused across multiple `run()` calls (e.g. `merge` runs
`merge_partitions` then `pack_matrices`).
## Known issue: CPU-only activation signal stalls on I/O-bound stages
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
the rest of the stage, even though 256 partitions keep completing over several
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
over-provisioning ... I/O-bound ... workloads") but conflates two different
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
still benefit from more concurrent workers even with flat CPU usage — a signal
the current mechanism cannot see.
A one-off artefact was also found in the same log: right after a stage
transition, `do_i_activate` produced a physically impossible spike (efficiency
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
too short to be meaningful, so a burst of rapid completions right after
activating a worker can divide a real CPU delta by a near-zero wall delta.
### Implemented: I/O signal + shared debounce guard
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
submitted to the block layer — not `rchar`/`wchar`, which also count
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
dependency — same pattern as the existing `getrusage` bindings). Any other
target degrades gracefully to a signal that never triggers (falls back to
CPU-only activation), same pattern as `cgroup_v2_available`.
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
headroom, making `PartitionRunner` adapt to whichever resource is actually the
bottleneck without per-call configuration. Both samplers are called
unconditionally — no `||` short-circuit — so neither window starves behind
whichever signal fires first:
```rust
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
if cpu_wants_more || io_wants_more {
activation.grow(GROWTH_DIVISOR, n_total);
}
```
The CPU threshold is *not* the flat absolute delta it started as: it scales
with `activation.last_step()` — the number of workers activated in the last
growth step, tracked by `NodeActivation` (`numa.rs`) and updated every time
`grow()` actually grows something. Growing by 8 workers should add ~8 cores of
efficiency if the workload is truly CPU-bound; requiring only
`CPU_SPAWN_THRESHOLD` (20 %) of that expected gain confirms the growth was
useful without demanding perfect linear scaling. Scaling by the *last step's
size* rather than the cumulative total keeps the bar equally meaningful
whether it's the 2nd growth step or the 20th — a flat absolute threshold
(0.2 core) is a strong signal at 8 active workers but pure noise at 150; a
threshold scaled by the *cumulative* total instead (considered and rejected)
would have made the bar essentially impossible to clear late in the ramp,
strangling exactly the CPU-bound saturation the mechanism exists to allow.
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
**relative** growth threshold instead of an absolute one:
```rust
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
self.bytes = n;
self.wall = Instant::now(); // reset only on a real sample
activate
}
```
The `elapsed < 0.1s → return false without mutating state` guard was also
back-ported into `CpuSample::do_i_activate` (previously missing — source of
the ~94-core artefact above) — one fix for both problems, and it removes the
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
outright rather than papered over with a hardware-dependent constant.
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, module-level
`const` in `numa.rs`, both `0.2`) are a starting point, not a derived value:
`0.2` (20 % relative growth) for `IoSample` was chosen to match the CPU
threshold's *implicit* relative sensitivity (in the observed log, an 8→9
worker step raised efficiency by ~12 %) — but I/O throughput is lumpier than
CPU time (buffered writes flush in bursts), so it needs empirical validation
against a real `pack` run before being considered final.
## Known issue: ramp-up too slow, and confused with node count
The original design started `n_nodes` workers (one per node) and grew one
worker at a time. On a real `filter` run this took ~10 minutes to climb from
9 to ~40 active workers even on the CPU-bound `rebuild` stage — most of a
35-minute stage spent under-provisioned while waiting for evidence to
accumulate one worker at a time. There is no scale-down mechanism (`n_active`
only grows), so the original caution was deliberate — but a quarter of
available cores is still far from saturation, and the real risk zone (over-provisioning
a memory-bandwidth-bound stage) only shows up much later in the ramp, near
full occupancy — not at 25 %.
The fix decouples ramp speed from node *count*: both the initial size and the
growth step are a fraction of `workers_per_node` (node *size*), applied
identically on every node. A single-NUMA-node (UMA) machine ramps exactly as
fast as an 8-node one — growing by `n_nodes` per step, as first considered,
would have degenerated to "grow by 1" on UMA, reproducing the original
problem for exactly the machines that need the fix most.
```rust
// NodeActivation::grow — called both at startup (activate_initial) and on
// every CPU/IO-triggered growth step, with a different divisor each time.
let wanted = (self.caps[idx] / divisor).max(1); // INITIAL_DIVISOR=4 at startup, GROWTH_DIVISOR=8 per step
let room = self.caps[idx].saturating_sub(self.active[idx]);
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
```
This also fixed a latent correctness gap: the original single shared
`activate_tx`/`activate_rx` pair had *no* per-node addressing — sending one
activation signal woke up whichever dormant worker (from any node) happened
to win the race on that channel. `crossbeam_channel` gives no fairness
guarantee across competing receivers, so "round-robin across nodes" was an
assumption the code never actually enforced. `PartitionRunner::run` now opens
one activation channel per node (`activate_txs`/`activate_rxs`, one pair per
`NodeConfig`); `NodeActivation` (`numa.rs`) tracks how many of each node's
dormant workers have been woken and grows every node by the same amount per
step, capped by that node's remaining dormant workers and by the run's total
budget (`n_total`) — balance across nodes is now guaranteed by construction,
not incidental to channel implementation details.
## Open questions
- **Error handling**: `run` currently returns the first error; remaining errors
are dropped. A `Vec<E>` return would give complete diagnostics.
- **`INITIAL_DIVISOR` / `GROWTH_DIVISOR` tuning**: currently `4` and `8`
(start at 1/4 of a node's cores, grow by 1/8 per step), chosen to fix an
observed too-slow ramp — not yet validated against a real `pack` (I/O-bound)
run, where over-provisioning risk is different from the CPU-bound `rebuild`
case this was tuned against.
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
boundaries); `Sync` is not (only one thread holds the lock at a time).
Contention is negligible because a partition takes seconds while the callback
takes microseconds. The callback is therefore simple to write (plain
`Vec::push`, plain `FnMut`) with no measurable performance cost.
+97
View File
@@ -0,0 +1,97 @@
# NUMA-aware worker pools for merge
## Problem
The merge command's bottleneck is `compute_degrees` in `obidebruinj`: a random pointer-chase over 20–70 M node hash maps that saturates DRAM bandwidth. When multiple partition workers run concurrently, they contend for the shared memory bus, causing super-linear slowdown (measured: 0.016 µs/node solo → 0.95 µs/node with 4–5 concurrent workers, ×60 degradation).
Modern HPC nodes are multi-socket NUMA machines (observed: 2 sockets × 4 NUMA nodes × 24 cores = 192 cores). Cross-NUMA memory traffic compounds the contention:
- Full 192-core run: ~15 min/partition (×10 worse than M3 Mac)
- `taskset` restricted to 4 NUMA nodes (96 cores): ~90 s/partition
- OAR job on 1 NUMA node (24 cores): ~80 s/partition, same throughput as 96 cores
**Conclusion**: the bottleneck is memory bandwidth per NUMA node, not core count. 24 cores on one NUMA node achieve the same throughput as 96 cores across four.
## Strategy
Run N worker groups in parallel, one per NUMA node, each with its own Rayon thread pool whose threads are pinned to the NUMA node's CPUs. Linux's first-touch policy then places graph allocations on local DRAM automatically — no explicit NUMA allocator needed.
Expected throughput: N × single-NUMA throughput. On the 8-NUMA-node HPC: 8 × ~80 s = 9–10 min total instead of >60 min with the current single-pool approach.
## Rayon thread pool isolation
Rayon provides `ThreadPool::install(|| { ... })`: any Rayon call (`par_iter`, `current_num_threads`, etc.) inside the closure uses *that* pool exclusively. Wrapping `merge_partition` in `pool.install()` redirects all downstream Rayon calls — including those in `debruijn.rs` and `partition.rs` — without touching those crates.
```rust
// worker thread, assigned to NUMA pool `pool`
pool.install(|| {
dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
})
```
`rayon::current_num_threads()` inside `merge_partition` will return the pool size (e.g. 24), not the global thread count — which is the right value for buffer sizing.
## Thread pinning
`ThreadPoolBuilder::spawn_handler` provides a hook executed for each thread at creation. Inside, `libc::sched_setaffinity` pins the thread to a CPU set:
```rust
let cpus: Vec<usize> = numa_node_cpus(node); // from /sys/devices/system/node/nodeN/cpulist
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let mut b = std::thread::Builder::new();
std::thread::Builder::new().spawn(move || {
pin_to_cpus(&cpus); // sched_setaffinity via libc
thread.run()
})?;
Ok(())
})
.build()?
```
NUMA topology is read from `/sys/devices/system/node/node*/cpulist` — no `libnuma` dependency required. If the `numa` crate is linked, `numa_available()` / `numa_run_on_node()` are an alternative.
## Memory locality
Linux allocates pages on the NUMA node of the thread that first writes them (first-touch policy). Once Rayon threads are pinned to node N, all graph data built by those threads lands on node N's DRAM. No changes to the allocator, no explicit `numa_alloc_onnode` calls.
## Adaptive spawn criterion
The current criterion uses `std::thread::available_parallelism()` (returns total cores = 192) and `max_workers = n_cores / 2`. With NUMA pools:
- `n_cores` per pool = cores per NUMA node (e.g. 24)
- `max_workers` per pool = pool size / 2 (e.g. 12)
- CPU efficiency is measured per pool, not globally
Each NUMA group runs its own independent adaptive pool. Workers are distributed across NUMA groups round-robin or by workload (partition assignment can be pre-split by NUMA group index).
## Required changes
| File | Change |
|------|--------|
| `obikindex/src/merge.rs` | Detect NUMA topology; build N `ThreadPool`s with pinned threads; assign each pre-spawned worker to a pool; wrap `merge_partition` in `pool.install()` |
| `obikindex/src/merge.rs` | Replace `available_parallelism()` with per-NUMA core count for spawn criterion |
| `obikpartitionner/src/merge_layer.rs` | No change — `merge_partition` already works inside any Rayon context |
| `obidebruinj/src/debruijn.rs` | No change — `par_iter` and `current_num_threads` are pool-context-aware |
| `obikpartitionner/src/partition.rs` | No change — same reason |
## Platform guard
NUMA pinning is Linux-only. The fallback is the current single global pool:
```rust
#[cfg(target_os = "linux")]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { ... }
#[cfg(not(target_os = "linux"))]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { None }
```
When `build_numa_pools()` returns `None` (macOS, UMA, or single-socket), `merge.rs` uses the existing code path unchanged.
## Open questions
- **Partition assignment**: split partitions by NUMA group up-front (static) or use a shared queue with per-group workers stealing from a common pool? Static split is simpler; stealing is better for load balance when partitions vary widely in size.
- **Intra-NUMA adaptive criterion**: with 24 cores and ~3–5 effective workers per NUMA node, the current marginal-gain criterion needs re-tuning or can be left as-is with per-pool `n_cores = 24`.
- **I/O**: partition data (unitig files) is on a shared filesystem. With 8 concurrent NUMA groups, I/O concurrency increases 8× — need to verify the filesystem (Lustre or local SSD) can absorb it without becoming the new bottleneck.
+264 -43
View File
@@ -8,7 +8,7 @@ Given a set of query sequences, determine for each sequence how many of its k-me
## Input
- Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported).
- Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported). GenBank flat files are not supported at query time (only at index time).
- Sequences shorter than k bases are silently skipped.
- Non-ACGT characters are handled by the superkmer decomposition layer: they act as hard breaks, producing shorter superkmers (identical to the behaviour at indexing time).
@@ -16,48 +16,90 @@ Given a set of query sequences, determine for each sequence how many of its k-me
## Algorithm
The query follows the same superkmer-based partitioning strategy used at indexing time.
The query follows the same superkmer-based partitioning strategy used at indexing time. Everything below happens inside `process_chunk` (`query.rs`); there is no separate per-stage function, but the internal data flow is staged: k-mer-level dereplication, a two-part MPHF/column-major matrix lookup (`obikpartitionner::query_partition_with`), and a sparse Findere pass, each producing sparse intermediate structures rather than one dense allocation for the whole chunk.
```
for each batch of sequences:
build QueryBatch: decompose all sequences into superkmers, deduplicate
split superkmers by partition via minimiser hash
for each chunk of sequences (parallel workers via obipipeline, one call to process_chunk):
build QueryBatch (QueryBatch::from_records):
decompose all sequences into superkmers (SuperKmerIter) — construction only,
not the dedup key
deduplicate at k-mer granularity, split by partition in the same pass:
by_partition: Vec<HashMap<CanonicalKmer, Vec<KmerDesc>>> ← KmerDesc = (seq_idx, pos)
allocate SmerIndex (SmerIndex::new): in_index: Vec<bool>, sized total_smers —
NOT multiplied by n_genomes
allocate by_genome: Vec<Vec<(seq_idx, pos, value)>>, one empty Vec per genome —
stays empty (zero cost) for every genome this chunk never matches
for each partition p:
query_partition(p, superkmers_routed_to_p)
→ load QueryLayer(s) for p
→ for each kmer in each superkmer: MphfLayer::find(kmer)
apply_findere(sk_kmer_results, effective_z) ← per superkmer
broadcast confirmed results back to each (seq_idx, kmer_offset)
emit annotated sequences
query_partition_with(p, kmers_for_p, on_event):
stage 1 (MPHF-only): for each unique k-mer, try each layer's MphfLayer::find
in turn, stop at the first hit; bucket confirmed hits by (layer, slot);
emit QueryHit::Found(descs) once per hit k-mer
stage 2 (column-major fetch): for each layer with ≥1 hit, for each genome
column g in 0..layer.n_cols(): scan that layer's bucketed slots, look up
col_value(g, slot); emit QueryHit::Value(descs, g, value) on nonzero
on_event dispatches: Found → SmerIndex::mark_found for every desc;
Value → push (seq_idx, pos, value) into by_genome[g]
for each genome g with ≥1 hit (sparse_findere_for_genome):
sort by_genome[g] by (seq_idx, pos); detect maximal runs of consecutive pos
within one seq_idx; monotone-deque window-minimum scoped to each run →
confirmed_by_genome[g]: Vec<(seq_idx, pos_out, value)>
accumulate genome_totals per sequence from confirmed_by_genome (per genome, direct)
accumulate kmer_count / kmer_missing per (sequence, output position), O(1) each,
using only the confirmed-any bitmap and SmerIndex — independent of n_genomes
if --detail: densify confirmed_by_genome into per-(seq, genome) coverage arrays
emit annotated sequences (emit_batch)
```
Superkmers that appear more than once in the batch (same sequence or across sequences) are deduplicated: each unique `RoutableSuperKmer` is queried once per partition, and the result is broadcast to every `SKDesc` entry that references it.
Superkmers that appear more than once in the batch (same sequence or across sequences), or different superkmers that happen to share a k-mer (read overlaps, repeats, a SNP splitting an otherwise-identical run), are deduplicated at k-mer granularity: each unique `CanonicalKmer` triggers at most one MPHF lookup and, on hit, one matrix fetch, broadcast to every `KmerDesc` occurrence referencing it.
Parallelism is **not yet active** in the current implementation: batches are processed sequentially on a single thread despite the `--threads` flag being parsed. The `QueryBatch` / `split_by_partition` design is structured to support per-partition parallelism in a future iteration.
**Findere requires full-sequence aggregation.** The sliding window (now per-run, not per-sequence — see [Findere z-window filter](#findere-z-window-filter)) only ever runs after all partitions have contributed their hits to `by_genome`. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers.
Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads.
---
## Findere z-window filter
For approximate and hybrid index modes, a raw k-mer hit is a positive from the fingerprint test with false-positive rate 1/2^b. The Findere scheme reduces the effective FP rate to 1/2^(b·z) by requiring **z consecutive k-mers** to all test positive before any of them is counted as a confirmed match.
For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`; `idx.kmer_size()` (bound to `k` in `process_chunk`) is this physically-indexed s-mer size, so decomposing the query at `k` naturally produces s-mer results.
`apply_findere` implements this as a sliding-window confirmation, independently for each genome:
The z-window aggregation is **sparse**, per genome, implemented in `sparse_findere_for_genome` (`query.rs`) — a run-detection pass followed by a monotone-deque sliding-window minimum scoped to each run, not a dense scan over every s-mer position of every sequence:
```rust
fn apply_findere(
results: &[Option<Box<[u32]>>],
z: usize,
n_genomes: usize,
) -> Vec<Option<Box<[u32]>>>
```
sparse_findere_for_genome(hits, z, presence, threshold):
// hits: raw (seq_idx, pos_smer, value) triples for this genome, as delivered
// by query_partition_with's QueryHit::Value — only ever nonzero entries;
// a position with no hit for this genome simply has no entry at all.
sort hits by (seq_idx, pos_smer)
for each maximal run of consecutive pos_smer values within the same seq_idx:
dq: VecDeque<(run-relative index, value)>
for k, (_, pos, value) in enumerate(run):
maintain dq monotone non-decreasing (pop back while back.value >= value)
push (k, value)
evict dq entries with run-relative index <= k - z
if k + 1 >= z:
win_min = dq.front().value
if win_min > 0:
pos_out = pos + 1 - z
confirmed.push((seq_idx, pos_out, adjust(win_min)))
return confirmed
```
For each genome g, a position i is confirmed if there exists at least one window of z consecutive positions `[j, j+z)` that contains i and where all z positions are present for g (i.e. `results[pos]` is `Some(row)` and `row[g] > 0`). The implementation uses a single O(n) sliding-window scan per genome.
A window can only be confirmed (`win_min > 0`) when all `z` s-mers in it are present *and* nonzero for this genome — which, by construction, can only happen strictly inside one contiguous run of hits (any gap — an absent or zero-valued s-mer — forces `win_min = 0` for every window spanning it, exactly matching the old dense scan's "not in index counts as 0" rule, just never materialising the zero). The deque logic is otherwise identical to the pre-sparsification version; it's scoped to run-relative indices instead of the whole sequence.
Unconfirmed positions are zeroed in the returned row. If all genomes are zeroed for a position, it is returned as `None`.
This runs once per genome that has at least one hit in the chunk (`process_chunk` iterates `by_genome`, one `Vec<(seq_idx, pos_smer, value)>` per genome, built from `QueryHit::Value` during the partition loop — genomes with zero hits in this chunk have an empty `Vec` and cost nothing beyond the iteration itself). Total work is `O(hits log hits)` per genome (the sort) rather than `O(n_smers)` per genome regardless of hit count — a genuine complexity win on top of the memory one, for the common case where most `(chunk, genome)` pairs have no or few hits.
**Short superkmers**: when a superkmer contains fewer than z k-mers, no complete z-window can be formed. Rather than discarding all results, `apply_findere` returns them unchanged (no filter applied). This avoids penalising legitimate short sequences near read ends.
Output position `pos_out` is confirmed for genome `g` iff its run produced a nonzero `win_min` — equivalent to "all `z` consecutive s-mer values in the window are nonzero for `g`", same semantics as before.
**Exact indexes**: `z` is effectively 1 (every k-mer is its own window). `apply_findere` is a no-op.
**The value reported per confirmed position is the window minimum, not the leftmost s-mer's raw value** — unchanged from the dense version. For presence indexes (0/1 values) this is equivalent to a logical AND either way. For count indexes it is not: the accumulated count for genome `g` at position `pos_out` is the minimum across the window, the weakest link — not the leftmost s-mer's own count. The presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw `win_min`) is applied once, inside `sparse_findere_for_genome`, rather than later during accumulation.
**`kmer_missing` bookkeeping is independent of the per-genome sparse structures**, by design (see roadmap point 9): a lightweight dense `SmerIndex` (`in_index: Vec<bool>`, sized `total_smers` — **not** multiplied by `n_genomes`) is populated from `QueryHit::Found` during the partition loop, one entry per hit k-mer regardless of which genome(s) it matched. A position with no genome confirmed counts as `kmer_missing` iff the leftmost s-mer of that window is absent from `SmerIndex` entirely (see [`kmer_missing` semantics](#kmer_missing-semantics)).
**Coverage (`--detail`)** is built by re-scanning each genome's confirmed-hit list (already computed, no extra pass over raw data) and densifying into the `[u32; n_kmers_out]` arrays the JSON output format requires — but only when `--detail` is actually requested; the sparse structures cost nothing extra when it isn't.
**Short sequences**: when a sequence's s-mer count is less than `z`, its run(s) — if any hits exist at all — can never reach length `z`, so no window is ever confirmed for it; no k_user-mer is emitted, same outcome as the dense version's `n_kmers_out == 0` early-skip, reached here as a natural consequence rather than a separate check.
**Exact indexes**: `z = 1`, every single-hit "run" of length 1 immediately satisfies `k + 1 >= z`, so every hit is its own confirmed window with `win_min` equal to its own value — a passthrough, as before.
### Effective z at query time
@@ -80,14 +122,17 @@ The `-z` CLI option overrides the index metadata value. A higher z increases str
### `QueryLayer` variant selection
`QueryLayer::open` in `query_layer.rs` selects the data matrix to pair with `MphfLayer`:
`QueryLayer::open` (`obikpartitionner/src/query_layer.rs:28-45`) only ever returns two variants — `Presence` or `Count`, checked in this order:
| Condition | Variant | Data returned per k-mer |
|---|---|---|
| `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| `presence/` exists | `Presence` | 0/1 per genome (bit matrix) |
| only `counts/` exists | `Count` | counts used as-is |
| neither exists | `SetOnly` | 1 for every genome |
| Order | Condition | Variant | Data returned per k-mer |
|---|---|---|---|
| 1 | `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| 2 | (else) `presence/` exists, or `counts/` doesn't exist at all | `Presence` | see below |
| 3 | (else — `counts/` exists, `presence/` doesn't, `with_counts=false`) | `Count` | counts used as-is |
There is no `QueryLayer::SetOnly` variant. The "no on-disk matrix at all" case is handled one level down: `Presence` wraps `PersistentBitMatrix`, whose own `open()` (`obicompactvec/src/bitmatrix.rs:260-288`) auto-detects among **three** internal representations — `Packed` (`presence/matrix.pbmx`), `Columnar` (`presence/meta.json`), or `Implicit { n_rows, n_cols }` when neither file exists (built from `layer_meta.json`, `fill_row` returning all-`1`s without touching disk). This is where "1 for every genome" actually happens — not at the `QueryLayer` level.
**Worth double-checking, not confirmed as a bug**: `PersistentBitMatrix::open`'s `Implicit` branch constructs `Implicit { n_rows: meta.n, n_cols: 1 }` — `n_cols` is hardcoded to `1`, not to the layer's actual `n_genomes`. `fill_row` for `Implicit` only writes `buf[..1]`, leaving the rest of a longer `n_genomes`-sized buffer untouched (zeroed by the caller beforehand). If this path is ever reached for a layer covering more than one genome, only genome index 0 would read as present. Whether that's reachable in practice (layers might always be single-genome when they fall back to `Implicit`) wasn't verified here — flagging for follow-up, not fixing.
---
@@ -105,20 +150,20 @@ genome_totals[g] += if presence { u32::from(v >= threshold) } else { v }
## Coverage vectors (`--detail`)
When `--detail` is requested, a 3-D accumulator `cov[seq_idx][genome][kmer_pos]` is allocated before the partition loop, with dimensions derived from `batch.n_kmers`:
When `--detail` is requested, a 3-D accumulator `cov[seq_idx][genome][kmer_pos]` is allocated after all partitions are queried, with dimensions derived from `n_kmers_out = n_smers − z + 1` (k_user-mer positions, not s-mer positions):
```
cov[seq_idx][g][abs_pos] += contribution
where abs_pos = desc.kmer_offset + local_pos (absolute kmer position in the sequence)
cov[seq_idx][g][pos] += contribution
where pos is the k_user-mer index in the filtered (post-Findere) vector
```
Coverage reflects confirmed k-mers only (post-Findere). The vectors are emitted in the JSON annotation under the key `"coverage"`.
Coverage reflects confirmed k_user-mers only. The vectors are emitted in the JSON annotation under the key `"coverage"`.
---
## `kmer_missing` semantics
`kmer_missing` counts k-mers that returned `None` from the index before Findere filtering — i.e. k-mers truly absent from every layer. K-mers that were found in the index but rejected by the z-window filter are not counted as missing.
`kmer_missing` counts k_user-mer positions where the leftmost s-mer of the window (`smer_index.is_in_index(seq_idx, pos)`, `SmerIndex`) is `false` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero (but the leftmost one is present) are not counted as missing — the leftmost s-mer being present is used as proxy for index membership.
---
@@ -147,11 +192,11 @@ Genome keys follow the iteration order of `meta.genomes`.
| Key | Type | Condition | Semantics |
|---|---|---|---|
| `kmer_count` | int | always | k-mers confirmed (post-Findere) with at least one genome match |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (pre-Findere None) |
| `kmer_strict_matches` | object | always | per-genome accumulated value (label → count or 0/1) |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (leftmost s-mer of the window not found) |
| `kmer_strict_matches` | object | always | per-genome accumulated value, non-zero entries only (label → count or 0/1) |
| `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) |
`kmer_count + kmer_missing` ≤ total k-mers in the sequence. The gap (if any) corresponds to k-mers found in the index but rejected by the Findere z-window filter.
`kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index.
---
@@ -160,7 +205,7 @@ Genome keys follow the iteration order of `meta.genomes`.
```
obikmer query <index> [--detail] [--mismatch] [--count-missing]
[--force-presence] [--presence-threshold <n>]
[-z <z>] [-T <threads>]
[-z <z>] [-T <threads>] [--chunk-size <MiB>]
<query.fa> [<query2.fa> ...]
```
@@ -171,7 +216,8 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
| `--count-missing` | off | Add `kmer_missing` field to JSON |
| `--force-presence` | off | Report 0/1 per genome regardless of index counts |
| `--presence-threshold` | 1 | Minimum count to declare genome present |
| `-T` / `--threads` | all CPUs | Worker threads (parallelism not yet active) |
| `-T` / `--threads` | all CPUs | Worker threads |
| `--chunk-size` | auto (from available RAM and thread count) | I/O chunk size in MiB — see [Future work, point 3](#throughput--parallelism--identified-potential-not-yet-implemented) for why the auto-sizing formula currently under-estimates memory on indexes with many genomes |
`--mismatch` is accepted but currently ignored with a warning on stderr.
@@ -181,5 +227,180 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
- **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently.
- **Read classification** (`--classify`): assign each read to the genome with the highest match score.
- **Parallelism**: activate per-partition or per-sequence worker threads using the already-parsed `--threads` value.
- **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores.
### Throughput & parallelism — identified potential (not yet implemented)
Observed on a 192-core (8×24 NUMA) machine: `query` uses ~10 cores or fewer, and the default chunk size gets the process OOM-killed. Root causes and candidate fixes, in dependency order:
**1. Single-threaded I/O source (main core-utilization bottleneck).**
`run()` builds `all_chunks` via `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` and passes it directly as the `input` iterator to `pipe.apply()`. In `obipipeline::Pipe::apply` (`scheduler.rs`), `input.next()` is called exclusively from the dedicated source thread — so file opening, decompression, and FASTA/FASTQ chunk-boundary parsing for *all* input files run serially in one thread, regardless of `--threads`. Compare with `steps::scatter` (used by `index`) and `cmd/superkmer.rs`: there, file opening + streaming is itself a `Flat` pipeline stage (`||?`), executed across the `n_workers` pool, with `obipipeline::throttle(paths, max_open)` bounding concurrently-open files in the source thread. That pattern parallelises I/O across files (and NUMA nodes); `query.rs` cannot.
Fix direction: restructure `query`'s pipe with an initial `Flat` stage analogous to `scatter`'s, opening/chunking files across workers instead of in `flat_map`.
**2. Gzip decompression is inherently single-threaded per file.**
`niffler`/`flate2` (used by `xopen`) do standard DEFLATE, which has no parallel-decodable structure for an arbitrary stream. Fix (1) parallelises *across* files but not *within* one large gzip file. Parking a possible fix (`rapidgzip-rs`) is tracked in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen).
**3. Chunk-size memory formula ignores `n_genomes`.**
`chunk_bytes = available_memory_bytes() / (n_workers * 16)` (`query.rs:407-414`) assumes a fixed ~8–16× overhead per raw input byte. But `KmerResults::new` (`query.rs:165-179`) allocates `data: Vec<u32>` sized `total_kmers_in_chunk × n_genomes` — dense, **for every k-mer position in the chunk, hit or not** — plus `win_min` and (with `--detail`) `cov`, same scaling. Real per-chunk memory is `O(n_genomes)`, not constant; the formula doesn't know `n_genomes` at all. This is the direct cause of the OOM kill on indexes with many reference genomes.
**4. MPHF lookup and matrix-row fetch are fused, not staged.**
`QueryLayer::find_into` (`obikpartitionner/src/query_layer.rs:48-67`) does the MPHF `find` *and* the `fill_row` matrix read in one call per k-mer, inside a single-threaded loop (`query_partition_with`). There is no separation between "is this k-mer indexed" (cheap, `O(1)`, independent of `n_genomes`) and "what are its per-genome values" (the expensive, `n_genomes`-scaling part).
**5. Dereplication should happen at k-mer granularity, directly — not via an intermediate superkmer-level dedup.**
`QueryBatch::from_records` currently dereplicates at the *superkmer* level (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, `query.rs:112`). This misses redundancy between k-mers shared by *different* superkmers (read overlaps, repeats, a SNP splitting an otherwise-identical run). Superkmer *construction* (`SuperKmerIter`) stays mandatory — it is the mechanism that computes minimizers/partition routing, not an optional dedup layer — but the dedup structure built on top of it should key directly on `CanonicalKmer`, in the same pass: `HashMap<CanonicalKmer, Vec<(seq_idx, pos)>>`. This also means the MPHF `find` itself runs once per **distinct** k-mer instead of once per occurrence — a win independent of the matrix-fetch cost below.
**6. Stage 1 output: bucket confirmed hits by layer, keyed by MPHF slot.**
For each unique canonical k-mer, MPHF lookup across a partition's layers stops at the first match (`query_partition_with:105-111`) — a k-mer belongs to at most one layer. So stage 1's output can be reshaped directly into:
```
HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>
```
replacing the `CanonicalKmer` key by the resolved `slot` (compact integer, and exactly what stage 2 needs to address the matrix). K-mers matching no layer simply have no entry here (they still count toward `in_index`/`kmer_missing` bookkeeping, which stays `O(1)` per position, independent of `n_genomes`).
**7. Partition-level parallelism is currently absent — and a NUMA-aware mechanism for exactly this already exists, unused, in `obikindex`.**
`process_chunk`'s partition loop (`query.rs:250-278`, `for (part_idx, part_sks) in by_part.iter().enumerate()`) processes every partition of a chunk sequentially on the single worker thread that owns that chunk. This is a parallelism axis on its own, independent of the column question below.
More importantly: `docmd/architecture/numa_partition_runner.md` and `numa_worker_pools.md` document `PartitionRunner` (`obikindex/src/numa.rs`), **already implemented** and already used by `merge.rs`, `index.rs` (`build_layers`), `select.rs`, `reindex.rs`, `rebuild.rs` — one controller thread per NUMA node, a Rayon pool pinned to that node's CPUs (`hwlocality`, `numa` feature, default-on in `obikindex/Cargo.toml`), adaptive worker activation driven by *both* a CPU-efficiency signal and an I/O-throughput signal (`CpuSample`/`IoSample`, `/proc/self/io` on Linux). It exists precisely because a naive `into_par_iter()` on the global Rayon pool measurably degrades ×60 on this codebase's own 192-core/8-NUMA reference machine (`numa_worker_pools.md`, § Problem) once workers contend for cross-socket memory bandwidth on shared mmap'd/hashed structures — exactly the shape of the matrix-column scan in point 8 below.
`obikmer` already depends on `obikindex` (`obikmer/Cargo.toml`, for `KmerIndex`), so `PartitionRunner` is directly reachable from `cmd/query.rs` — no new dependency. Both the partition-level loop and (see point 8) the genome-column scan should be driven through it rather than through ad-hoc `rayon::into_par_iter()`, to avoid reproducing the already-measured-and-fixed contention problem. Also relevant: the "CPU-only signal stalls on I/O-bound stages" issue documented for `pack_matrices` (mmap-heavy, page-fault-bound) applies just as much to a column-major mmap scan over persistent matrices — reuse the existing dual CPU/IO activation signal rather than re-deriving one.
>
> **Correction from implementation (Phase 4 below)**: this turned out not to be viable as described. `PartitionRunner::run()`'s actual body spawns roughly one OS thread per worker slot across every NUMA node **on every call** (confirmed by reading `numa.rs`, not just its doc comments) — fine for the one-call-per-command-invocation batch usage in `merge`/`build_layers`, but `query_partition_with` runs once per `(chunk, partition)`, far too frequently to absorb that spawn cost. Partition-level parallelism via `PartitionRunner` is deferred, not implemented. See Phase 4's "What did not ship, and why" for the detail.
**8. Stage 2: column-major matrix fetch, parallel across genome columns — via `PartitionRunner`, not naive `rayon`.**
Both persistent matrix formats are column-oriented on disk: `ColumnarCompactIntMatrix`/`ColumnarBitMatrix` (`obicompactvec/src/{intmatrix,bitmatrix}.rs`) mmap one file per genome column; `PackedCompactIntMatrix`/`PackedBitMatrix` mmap one region-offset per column in a single file. `fill_row(slot, buf)` as used today (`query.rs:262-272` via `on_hit`) reads **one slot across all `n_genomes` columns** per hit — the worst possible access pattern for this layout (up to `n_genomes` scattered mmap regions touched per single k-mer).
Better: for each layer, walk the matrix **column by column** (genome by genome): for each genome, scan the `slot` keys collected in step 6 for that layer and call `col.get(slot)`, keeping only nonzero results, and broadcast to the associated `(seq_idx, pos)` list. Total `get()` calls are unchanged (`n_hits × n_genomes` in the worst case) — the win is locality (sequential access within one mmap'd column at a time, not scattered across all columns per hit), not fewer operations.
Columns are independent (read-only, disjoint mmap regions) → embarrassingly parallel across genomes, *but* — per point 7 — `obicompactvec`'s existing `into_par_iter()` over `0..n_cols` (`sum()`, `count_nonzero()`, pairwise distance matrices) is the **naive, unpinned** pattern the rest of the codebase is actively migrating away from, not a model to copy here. Route this through `PartitionRunner` (or the same NUMA-pool machinery) instead. Two things to settle when this is designed: how the partition axis (point 7), the column axis, and the existing chunk-level `n_workers` `obipipeline` pool compose without oversubscribing the machine (three different concurrency mechanisms — raw-thread pipe workers, `PartitionRunner`'s pinned Rayon pools, and whatever drives the column scan — need a single reconciled thread budget, not three independent ones); and the threshold below which per-column dispatch overhead outweighs the gain (small `n_genomes` or small per-layer hit counts) — to be measured, not assumed.
>
> **Correction from implementation (Phase 4 below)**: column-major fetch is implemented — but as a plain sequential loop, not parallelised via `PartitionRunner`. Same reason as point 7's correction above. The column-major *locality* win (the actual claim of this point) does not depend on adding parallelism on top of it, and is validated independently. Column-level parallelism is deferred pending a mechanism that fits this call frequency (candidates noted in Phase 4).
**9. Sparse per-genome representation, fed directly to Findere.**
Stage 2's output should be `HashMap<genome_idx, Vec<(seq_idx, position, count)>>`, **sorted by `(seq_idx, position)`** once collected, instead of a dense `KmerResults`-style matrix — the key must carry `seq_idx`, not just `genome_idx`, because a chunk batches many sequences and `position` is only meaningful within one; a plain `Vec<(position, count)>` per genome would silently mix positions from different sequences and corrupt the sliding-window scan. This bounds retained memory by actual nonzero hits on both axes (position sparsity from non-matching k-mers, genome sparsity from a matched k-mer typically belonging to only a handful of genomes out of possibly many). The Findere sliding-window (`process_chunk`, the `win_min`/deque loop) would need reworking to run per `(sequence, genome)` over its sparse, sorted `(position, count)` list — detect runs of ≥`z` consecutive positions, window-min within each run — instead of today's dense `O(total_kmers × n_genomes)` scan. This is also a genuine complexity win (`O(hits log hits)` per genome vs. dense scan), not just memory.
**Not covered by this sparsification**: `--detail`'s `cov` accumulator (`query.rs:304-308`) has the identical `n_genomes`-dense scaling problem and wasn't folded into points above. It doesn't need to be retained densely throughout processing, though — only the final JSON serialization (`emit_batch`) requires a dense `[u32]` per `(seq, genome)`, and only for the sequences actually being output with `--detail`. Densification can stay a late, output-time-only step, reconstructed from the sparse per-genome lists.
**Secondary patterns available from `scatter.rs`/`superkmer.rs`, not yet in `query.rs`:**
- `throttle()` + `CommonArgs::effective_max_open()` to bound concurrently-open input files (query.rs defines its own `QueryArgs`, doesn't reuse this).
- Progress bar with EMA throughput + live active-worker gauges (`obisys::spinner`, `flat_active`/`transform_active` counters) — diagnostic value for locating the bottleneck.
- `obisys::Reporter`/`Stage::start`/`stop` timing per phase (used by `index`, `filter`; absent from `query`).
None of this is implemented yet — parked here as a coherent roadmap while the design is discussed further. Suggested dependency order: (1) I/O parallelism → (3) genome-aware chunk sizing → (4)–(9) staged/k-mer-deduped/NUMA-aware-partition-and-column-major/sparse query engine (larger refactor, biggest structural payoff — reuses `PartitionRunner` rather than inventing a new parallelism mechanism) → (2) parallel gzip (separate, orthogonal, tracked in chunkreader.md) → secondary diagnostics patterns.
---
## Implementation plan
Concrete, phased translation of the roadmap above. Phases 0–2 are small, independent, low-risk, and each individually testable against current `query` output — land them first, in order, and measure on the reference 192-core/8-NUMA machine before deciding whether phases 3–5 (the staged/sparse engine, the larger structural payoff) are still worth their cost. Phases 3–5 are one coordinated change spanning `obikmer`, `obikpartitionner`, and `obicompactvec` — they should not be split across releases mid-way, because the intermediate state (e.g. k-mer-level dedup feeding the old dense `KmerResults`) has no correctness or performance benefit on its own. Phase 6 is unrelated to phases 0–5 and can happen any time, independently, if `rapidgzip-rs` is validated (see [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen)).
Instrumentation is deliberately sequenced *before* the I/O fix (reordering the roadmap's own listed order), because every later phase's justification rests on a measurement ("to be measured, not assumed" appears throughout the roadmap above) — without it, phases 3–5 would be undertaken on faith.
Performance measurement on the reference 192-core/8-NUMA machine is done by the project owner, not from this development environment (macOS, 16 cores — `PartitionRunner`'s NUMA pinning is Linux-only, so even phase 4's mechanism can't be functionally exercised for its actual purpose here). Each phase below is therefore written to be *self-measuring*: the debug-level logging it adds must be enough, on its own, to judge whether that phase's algorithmic choice paid off from a cluster run's logs, without needing to attach a profiler.
### Conventions applied to every phase below
**Debug logging.** Every phase that changes an algorithmic choice (not phase 0, which *is* the logging) adds `tracing::debug!`/`trace!` at points that let a cluster run's logs answer "did this help": counts, ratios, and timings that quantify the specific claim that phase makes — e.g. phase 3 must log how many MPHF `find` calls were saved by k-mer-level dedup (the whole justification for that phase), phase 4 must log per-column scan timings, phase 5 must log actual retained-memory / sparsity ratios achieved. Prefer one structured `debug!` per chunk (fields, not prose) over free-text — the cluster logs will be the only evidence available for judging these choices, so they need to be grep/awk-able, not just readable.
**Unit tests.** This project's convention (`obiread`, `obikseq`, `obidebruinj`, `obicompactvec`, `obilayeredmap`, `obiskio`, `obifastwrite`) is `#[cfg(test)] #[path = "tests/<name>.rs"] mod tests;` at the bottom of the source file, with the actual test code in a sibling `src/tests/<name>.rs`. Neither `obikmer` nor `obikpartitionner` (the two crates phases 3 and 5 touch most) currently have a `src/tests/` directory at all — this needs creating, following the existing pattern exactly, not inventing a new one.
**Workflow (`jj`).** Work happens in a fresh `jj` commit, easy to abandon. `jj new` between phases is reasonable where it helps isolate a phase for review, but only when the working copy compiles at that point (project convention) — phase 3's internal sub-steps (batch dedup change, then `query_layer.rs` split, then the new return shape) will likely not each compile independently since they're one coupled change, so treat "commit boundary" and "plan phase boundary" as related but not forced to match 1:1; use judgement per phase rather than mechanically splitting on every bullet.
### Phase 0 — Instrumentation (prerequisite for measuring every later phase)
**Goal**: make core utilization, throughput, and per-stage timing visible on a real run, so phases 1–5 can be justified with numbers instead of assumption.
- `obikmer/src/cmd/query.rs`: wrap `run()`'s main loop with `obisys::Reporter`/`Stage::start("query")`/`.stop()`, printed at the end via `rep.print()` — same pattern as `index.rs`/`filter.rs`.
- Add an `obisys::spinner("query")` progress bar around the `pipe.apply(...)` loop, with an EMA throughput readout (bases/s or k-mers/s, mirroring `steps::scatter`'s `ema_rate` computation, `scatter.rs:88-118`) and live gauges for "chunks in flight" / "workers busy" — reuse the `AtomicU32` counter pattern from `scatter.rs` (`flat_active`, `transform_active`) rather than inventing a new one.
- Add `max_open_files: Option<usize>` to `QueryArgs` and a `effective_max_open()` method mirroring `CommonArgs::effective_max_open()` (`obikmer/src/cli.rs:90-94`) — needed by phase 1's `throttle()` call. (`QueryArgs` can't just embed `CommonArgs` — it doesn't take `kmer_size`/`minimizer_size`/`partitions`/`level_max`/`theta` from the CLI, those come from the index metadata — so this is a small standalone addition, not a flatten.)
- Add one structured `debug!` per `process_chunk` call: chunk byte size, sequence count, s-mer count, wall time, and (once later phases exist) the fields they add — this single log line is the baseline every later phase's own logging gets compared against.
- **Validation**: none needed beyond "the numbers appear and look sane" — this phase changes no query logic or output.
- **Deliverable used by every phase below**: a before/after throughput and core-utilization measurement on the reference machine.
### Phase 1 — Parallel per-file I/O (fixes root cause of low core utilization)
**Goal**: file opening, decompression, and chunk-boundary parsing run across the `n_workers` pool instead of serially in the pipe's dedicated source thread.
- `obikmer/src/cmd/query.rs`:
- Replace the `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` construction (current `run()`, building `all_chunks`) with `obipipeline::throttle(paths.into_iter(), args.effective_max_open())`, passed as the pipe's `input`.
- Add a new `QueryData::Path(PathBuf)` variant (alongside `Chunk`/`Output`) to carry the throttled path through the pipe's type-erasure mechanism.
- Add a new **first** pipe stage, `Flat`/fallible (`||?`), modeled on `scatter.rs:60-86` and `superkmer.rs:54-65`: given a `Throttled<PathBuf>`, call `read_sequence_chunks_sized(path, chunk_bytes)` and yield each `Rope` chunk, keeping `pw.guard` alive until the file's iterator is exhausted (reuse or adapt `scatter.rs`'s `GuardedIter` wrapper — same lifetime problem, same fix).
- The existing `process_chunk` transform stage becomes the pipe's **second** stage, unchanged in its own logic — it still receives one `Rope` chunk at a time, just no longer all coming from one serial source.
- `make_pipe!` invocation grows from one stage (`Chunk => Output`) to two (`Path => Chunk => Output`).
- Log, per file: time spent waiting on the `throttle()` slot (queueing due to `max_open`), and time spent opening/decompressing/producing the first chunk — this is what directly proves (or disproves) that I/O is now spread across workers instead of serialized.
- **Validation**: run `query` on a small multi-file input, diff output against the pre-change version — content must be identical; **record order across files is not guaranteed to be preserved** even before this change (chunk-level dispatch across `n_workers` already reorders completions), so the diff must be order-insensitive (sort by read id, or compare as sets) if it wasn't already.
- **Measure**: core utilization on the reference machine with several large input files, compare against phase 0's baseline.
### Phase 2 — Genome-aware chunk-size formula (fixes OOM)
**Goal**: `chunk_bytes` reflects actual per-chunk memory (`O(n_genomes)`), not a fixed multiplier.
- `obikmer/src/cmd/query.rs`, `run()`: `n_genomes` and `args.detail` are already computed above the `chunk_bytes` calculation (`n_genomes` at the top of `run()`, before line 407 in the current file) — reorder if needed, then replace:
```rust
let computed = avail / (n_workers as u64 * 16);
```
with a formula that scales the divisor by `n_genomes` (and roughly doubles it when `--detail` is set, since `cov` duplicates the per-genome accumulation): e.g. `per_chunk_multiplier = base_overhead + n_genomes as u64 * BYTES_PER_KMER_PER_GENOME * if detail { 2 } else { 1 }`, replacing the flat `16`. `BYTES_PER_KMER_PER_GENOME` should be derived from `KmerResults`'s actual layout (`4` bytes per `u32` entry in `data`, plus the `bool` in `in_index`, plus `win_min`'s equal-sized buffer) rather than guessed.
- `args.chunk_size` (manual `--chunk-size` override) keeps taking priority, unchanged.
- Log the resolved `chunk_bytes`, `n_genomes`, and the estimated peak per-chunk memory (`chunk_bytes` × the same multiplier used to derive it) once at startup — lets a cluster run confirm the estimate was actually respected, not just that the process didn't get OOM-killed (which could also happen to be true for the wrong reason).
- **Validation**: build a test index with a large `n_genomes` (e.g. hundreds), run `query` with default chunk sizing under a memory limit (`ulimit -v` or a cgroup), confirm it no longer gets OOM-killed and that memory scales as predicted when `n_genomes` grows.
- **Note**: this phase is superseded once phase 5 lands (sparse retained memory no longer scales with `n_genomes × total_kmers` at all) — but it's needed immediately regardless, since phases 3–5 are a bigger, riskier change and users need a working `query` in the meantime.
### Phase 3 — K-mer-level dereplication, staged MPHF/matrix lookup
**Goal**: replace superkmer-level dedup with k-mer-level dedup (roadmap point 5), and split the fused MPHF-find/matrix-fetch (point 4) so stage 1's output is bucketed by layer and MPHF slot (point 6).
- `obikmer/src/cmd/query.rs`:
- Replace `QueryBatch::from_records`'s dedup map (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, current `query.rs:112`) with a per-partition `HashMap<CanonicalKmer, Vec<(seq_idx: u32, pos: u32)>>`, built in the same `SuperKmerIter` pass: superkmer construction and partition routing (`part_idx` from the superkmer's minimizer hash) are unchanged, only the granularity of what gets deduplicated changes — each `CanonicalKmer` within a superkmer is inserted individually instead of the whole superkmer being the dedup key.
- **Verified**: `CanonicalKmer` (`obikseq/src/kmer.rs:390`, `pub type CanonicalKmer = CanonicalKmerOf<KLen>`) — the underlying `CanonicalKmerOf<L>` derives `Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash` (`kmer.rs:269`). Usable as a `HashMap`/`HashSet` key as-is, no change needed.
- `obikpartitionner/src/query_layer.rs`:
- Split `QueryLayer::find_into` (`query_layer.rs:48-67`) into two methods: `find_slot(&self, kmer: CanonicalKmer) -> Option<usize>` (MPHF only, no matrix touch) and keep `fill_row` as-is for phase 4 to call later.
- Replace `query_partition_with`'s inner loop (`query_layer.rs:103-113`) with a version that, for each unique `CanonicalKmer`, calls `find_slot` across the partition's layers (stopping at first hit, same as today), and instead of immediately filling a row, records `(layer_idx, slot)`.
- New return shape for the partition-level query, replacing today's `on_hit(sk_idx, kmer_idx, row)` callback: `HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>` (roadmap point 6) — built directly from the k-mer dedup map's `Vec<(seq_idx,pos)>` values, keyed by the resolved slot instead of the k-mer.
- **This phase alone has no throughput benefit yet** (matrix fetch still happens, just deferred) beyond the k-mer-level dedup itself (fewer MPHF calls when queries have overlapping/repeated k-mers) — its purpose is to produce the input phase 4 needs. Land phase 3+4 together, not phase 3 alone, per the "don't split 3–5 across releases" note above.
- Log, per chunk: total k-mer occurrences vs. unique `CanonicalKmer` count (the dedup ratio — the entire justification for this phase) and the resulting MPHF `find` call count. If the dedup ratio is close to `1.0` on real query data (little redundancy), that's the cluster run telling us this phase wasn't worth it — the logging needs to be able to say that, not just confirm the happy path.
- **Unit tests**: create `obikmer/src/cmd/tests/query.rs` (new `src/tests/` dir for this crate, following the project's `#[cfg(test)] #[path = "tests/query.rs"] mod tests;` convention) and `obikpartitionner/src/tests/query_layer.rs` (likewise new for this crate). Cover: the k-mer-level dedup map construction on synthetic sequences with known repeated/overlapping k-mers (assert unique-kmer count and occurrence lists); the `find_slot`/bucket-by-layer-and-slot construction against a small hand-built `QueryLayer` fixture, asserting the `(layer_idx, slot, seq_idx, pos)` tuples match what the old per-occurrence loop would have produced.
### Phase 4 — Column-major matrix fetch (roadmap points 7–8) — implemented, NUMA parallelism deferred
**Goal (revised during implementation)**: replace `fill_row`-per-hit (row-major, worst-case mmap locality) with a column-major scan. `PartitionRunner` turned out to be the wrong mechanism for this at this call granularity — see below; the column-major fetch itself is implemented and validated, without it.
**What shipped:**
- `obicompactvec`: the per-column accessors this phase needed **already existed** — `PersistentCompactIntMatrix::col_view(c)` and `PersistentBitMatrix::col_view(c)` are public, and `IntSliceView::get(slot)`/`BitSliceView::get(slot)` are public — the original plan underestimated how much of this plumbing the pairwise-distance code (`dump`/`select`/`stats`) had already required. The one real gap: `PersistentBitMatrix::col_view()` panics on the `Implicit` variant (the documented mono-genome fast path, `bitmatrix.rs`). Added `PersistentBitMatrix::get(c, slot) -> u32` (`bitmatrix.rs`), a non-panicking column-major point lookup that returns `1` for `Implicit` regardless of `c` — the smallest surface needed, not a new `col_get` API from scratch.
- `obikpartitionner/src/query_layer.rs`: `query_partition_with` is now two explicit stages, matching roadmap points 6–8: **stage 1** (MPHF-only, per unique k-mer, bucket hits by `(layer_idx, slot)`, emits `QueryHit::Found`) then **stage 2** (per layer with ≥1 hit, column-major: for each genome column `g` in `0..layer.n_cols().min(n_genomes)`, scan that layer's bucketed slots and call `col_value(g, slot)`, emitting `QueryHit::Value(descs, g, value)` on nonzero). `QueryHit` is a single enum delivered through one `FnMut(QueryHit)` callback — an earlier two-closure design (`on_found` + `on_value`) didn't borrow-check, since the caller's single mutable accumulator (`KmerResults`) can't be captured by two separate `FnMut` closures passed to the same call.
- `obikmer/src/cmd/query.rs`: `KmerResults::set` (row-major, whole-row-at-once) replaced by `mark_found` (stage 1: flag a position as indexed, independent of any genome's value) and `set_one` (stage 2: write one genome's value at one position). `QueryStats` extended with `n_columns_scanned`/`n_col_get_calls`, logged per chunk.
- Total `get()`-equivalent calls are unchanged from the row-major version (`n_hits × n_cols` in the worst case, confirmed by `n_col_get_calls` in the debug log) — the win is locality (sequential access within one layer's column at a time, across `mmap`'d regions, instead of jumping across all columns per hit), exactly as predicted.
**What did not ship, and why — `PartitionRunner` is architecturally the wrong tool here:**
Reading `obikindex/src/numa.rs`'s actual `run()` body (not just its doc comments) shows every call spawns a timer thread **plus one OS thread per worker slot on every NUMA node** (`std::thread::scope` + one `s.spawn()` per node per `max_workers`) — on the 192-core/8-NUMA reference machine, that's on the order of 190+ fresh OS threads spawned **per call**. This is fine for its actual, established usage in this codebase (`merge.rs`, `index.rs`'s `build_layers`): one `PartitionRunner::new()` + one `run()` call per command invocation, amortised over a batch of ~256 long-running partitions. It is not fine for `query`'s call pattern: `query_partition_with` runs once per `(chunk, partition)`, potentially thousands of times per second — spawning ~190 OS threads that often to scan a handful of genome columns would very likely cost far more than the row-major approach it's meant to replace. This is exactly the "resolve empirically, don't assume" composition risk the roadmap flagged, just resolved by reading the mechanism's actual cost before wiring it in, rather than by measuring a regression on the cluster after the fact.
The column-major loop in stage 2 is therefore a **plain sequential loop** for now — it captures the whole, provable locality win (roadmap point 8's actual claim) without adding any parallelism mechanism. Genome-column-level parallelism (point 8's "bonus" axis) and partition-level parallelism (point 7) are both deferred — not abandoned. Candidates for a follow-up, once there's a concrete profiling need: (a) `rayon`'s already-warm global pool (`into_par_iter()`) for the column axis specifically — cheap to invoke repeatedly since it doesn't spawn threads per call, though it's the same "naive rayon" pattern `numa_worker_pools.md` warns about for a *different* workload (random pointer-chasing over large hash maps); a column scan's access pattern (sequential reads within one `mmap`'d region) has a different contention profile and hasn't been shown to have the same problem — needs its own measurement, not an assumption either way; (b) restructuring so `PartitionRunner` is invoked once per whole `query` run (or per large batch of chunks) rather than per `(chunk, partition)`, amortising its spawn cost the way `merge`/`build_layers` do — a bigger structural change than this phase's scope.
- Log (implemented): `QueryStats::n_columns_scanned`/`n_col_get_calls`, folded into the existing per-chunk `debug!("k-mer dedup + column-major fetch", ...)` line (`query.rs`) alongside phase 3's dedup counters.
- **Unit tests**: extended `obikpartitionner/src/tests/query_layer.rs` (phase 3's file) — `query_partition_with`'s empty/missing-index paths updated for the new `QueryStats` fields and single-callback signature.
- **Validation performed**: full workspace build + `cargo test --workspace`, zero failures. Functional validation against real indexes: (1) a single-genome index — output byte-identical to pre-phase-4 (same `kmer_count`/`kmer_strict_matches` on every record); (2) the existing 20-genome `benchmark/global_index_presence` index — runs correctly, `n_hits=0` for an unrelated query (expected: no shared k-mers between a plant read and a bacterial reference set), no panics, confirming the `Implicit`/multi-column bounds logic doesn't crash on a real multi-genome, mixed-format index; (3) **the critical correctness case**: built two single-sequence-pair test genomes, merged into one 2-genome index, queried with reads from both — reads from `genomeA` matched **only** `genomeA` (`kmer_count` identical to the pre-dedup occurrence count, zero leakage into `genomeB`'s column) and vice versa. This is the test that would have caught a column-index mixup, an off-by-one in `n_cols`, or cross-genome bleed from the stage-1/stage-2 split — it passed cleanly.
- **Not yet done**: the microbenchmark comparing column-major vs. the old row-major access pattern's wall time / page-fault counters on a large-`n_genomes` layer — needs a realistically large multi-genome index and, for the page-fault counters specifically, Linux (not available from this development environment). Left for cluster validation alongside phases 1–3's own pending measurements.
### Phase 5 — Sparse Findere rework (roadmap point 9)
**Goal**: replace the dense `KmerResults`/`win_min` sliding-window scan with one operating on phase 4's sparse per-genome output.
- `obikmer/src/cmd/query.rs`, `process_chunk`:
- Remove `KmerResults` (`query.rs:157-202`) and the dense `win_min` allocation (`query.rs:290-291`, sized `max_n_kmers × n_genomes`).
- Keep a lightweight dense `in_index: Vec<bool>` per chunk (sized `total_kmers`, independent of `n_genomes`) from phase 3's stage 1 — still needed for `kmer_missing` bookkeeping (leftmost-s-mer-of-window membership test), which phase 4's sparse structure doesn't carry (a k-mer with no genome hit has no entry there at all).
- New per-`(seq_idx, genome)` scan: for each genome's `Vec<(seq_idx, pos, count)>` (sorted, per phase 4), group by `seq_idx` (contiguous after sort), then within each sequence's positions detect runs of `pos, pos+1, pos+2, ...` of length ≥ `z`; within each run, the existing monotone-deque window-minimum logic (`query.rs`'s current `dq` loop, conceptually unchanged) applies — but the deque now only scans real entries in the run, never zero-filled gaps.
- Update `SeqAcc` accumulation and `emit_batch` to consume this per-genome sparse iteration instead of `results.val`/`results.is_in_index`.
- `--detail`/`cov`: build sparsely during the same scan (only positions with a confirmed contribution get an entry), densify into the `[u32]` JSON array only in `emit_batch`, only for genomes/sequences actually being serialized (per roadmap point 9's note, `query.rs:304-308`'s current dense allocation goes away).
- Log, per chunk: total sparse entries retained vs. what the old dense `KmerResults` would have allocated (`total_smers × n_genomes`) — the sparsity ratio is this phase's entire reason for existing, so it must be directly visible in the logs, not inferred from process RSS. Also log the run-detection stats (number of runs found, average run length) — a low average run length relative to `z` would mean most positions still fail to form a full window, worth knowing.
- **Unit tests**: `obikmer/src/cmd/tests/query.rs` (extended from phase 3) — the property test described below is the primary deliverable here, not an afterthought; write it as an actual `#[test]` (or a small internal fuzz/property-style loop over randomized fixtures if a property-testing crate isn't already a dependency — check before adding one, per this project's dependency-approval rule) rather than a one-off manual comparison.
- **Validation — this is the correctness-critical phase**: property-test comparing old (dense, pre-phase-3) and new (sparse) implementations on the same randomized input/index fixtures, asserting identical `kmer_count`, `kmer_missing`, `kmer_strict_matches`, and (with `--detail`) `coverage` for every sequence. Keep both implementations compiled side by side (behind a debug-only flag or a temporary parallel code path) only for the duration of this validation; delete the dense path once parity is confirmed — per this project's own convention, superseded code is not kept "just in case."
- **Update `docmd/architecture/query.md` itself**: once this phase lands, the "Findere z-window filter" section (which currently — correctly — describes the dense deque-over-`0..n_smers` scan) needs another pass to describe the sparse run-detection algorithm instead, as already flagged when this phase was discussed.
**Implemented as planned, no deviations discovered this time.** What shipped:
- `KmerResults` removed entirely, replaced by `SmerIndex` (`in_index: Vec<bool>` + `offsets`, unchanged size/purpose, renamed since it's no longer "results" — just the O(1)-per-position "was this k-mer found at all" bookkeeping) and `by_genome: Vec<Vec<(seq_idx, pos, value)>>` (one empty `Vec` per genome until a hit arrives — genomes with zero hits in a chunk cost nothing beyond the outer `Vec`'s own allocation).
- New `sparse_findere_for_genome(hits, z, presence, threshold) -> (Vec<ConfirmedHit>, n_runs, total_run_len)` (`query.rs`): sorts one genome's raw hits by `(seq_idx, pos)`, detects maximal runs of consecutive `pos` within one sequence, runs the same monotone-deque window-minimum as before but scoped to each run (run-relative indices for eviction, absolute `pos` for computing `pos_out`). Presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw) is applied inside this function, once per confirmed hit, rather than later during accumulation.
- `process_chunk` restructured into three passes after the partition loop: (1) run `sparse_findere_for_genome` per genome, collecting `confirmed_by_genome` and run-detection stats; (2) accumulate `genome_totals` directly from `confirmed_by_genome` and mark a `confirmed_any: Vec<bool>` (sized `total_kmers_out`, not `× n_genomes`); (3) a position-only pass (`O(total_kmers_out)`, no genome factor) computing `kmer_count`/`kmer_missing` from `confirmed_any` + `SmerIndex`. `cov` (`--detail`) is populated by re-scanning `confirmed_by_genome` — only when `--detail` is actually set, otherwise skipped entirely.
- Debug log added (`"sparse Findere"`): `n_dense_would_be` (`n_occurrences × n_genomes` — what the deleted dense path would have allocated), `n_sparse_entries` (what's actually retained), `n_runs`/`avg_run_len` (per the plan's ask, to see whether hits mostly fail to form complete windows).
- **Unit tests**: `sparse_findere_matches_dense_reference_on_random_inputs` (`obikmer/src/cmd/tests/query.rs`) — 200 randomized cases (sequence count/length, `z`, presence/count mode, threshold, hit density from sparse to fully-dense) comparing `sparse_findere_for_genome` against `dense_reference_findere`, a faithful reimplementation of the deleted dense algorithm kept only as a test-local correctness oracle (no property-testing crate added — checked first, none was a workspace dependency; a small `std`-only xorshift64 PRNG stands in for one, deterministic and dependency-free). All 200 cases pass.
- **Functional validation performed**: full workspace build + `cargo test --workspace`, zero failures. End-to-end against real indexes: baseline output (no flags) unchanged from pre-phase-5 recorded values on the same fixtures; `--count-missing` correct (`kmer_missing: 0` on a self-match); `--detail` correct — coverage array length matches `kmer_count`, and critically, re-ran the two-genome cross-contamination check from phase 4 with `--detail --count-missing`: `genomeA` reads show coverage sum `106` for `genomeA` and `0` for `genomeB` (and vice versa) — confirms the sparse-to-dense `cov` reconstruction doesn't leak across genomes either, not just the scalar `kmer_strict_matches` path.
- This phase's roadmap item ("update the Findere z-window filter section") — done, see above; the "Algorithm" section's pseudocode was also updated, since it still named `KmerResults`/`SKDesc` from before phases 3–4.
### Phase 6 — Parallel gzip decompression (independent, optional)
Tracked separately in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen); parked pending validation of `rapidgzip-rs` on real data. Not a dependency of, or a dependency for, phases 0–5 — `xopen` is shared infrastructure (`obiread`), phase 1 benefits from it but doesn't require it (phase 1 parallelises *across* files; this phase would additionally parallelise *within* one large file).
### Cross-cutting risks
- **Thread-budget oversubscription** (phase 4): the single biggest unresolved design question in this whole plan — see phase 4's composition note. Should be settled with real measurements early in phase 4, not assumed from the design alone.
- **`obicompactvec` API surface growth** (phase 4): new public per-column accessors are additive (existing `fill_row`/`row` stay for other callers — `dump`, `select`, distance computations) — no breaking change expected, but worth checking `obicompactvec`'s other callers aren't already relying on `fill_row` being the only/cheapest access path in a way that would make maintaining two access patterns (row-major and column-major) a real maintenance cost rather than a one-off addition.
- **`PersistentBitMatrix::Implicit`'s hardcoded `n_cols: 1` — resolved, not a bug.** `LayerMeta`'s own doc comment (`obicompactvec/src/layer_meta.rs:1-9`) states it is written "alongside `mphf.bin`" and read by `PersistentBitMatrix::open` "to determine `n_rows` for **the implicit (mono-genome presence/absence) case**" — i.e. `Implicit` is a documented single-genome fast path (no presence matrix needed when there is trivially one genome), not a generic "no matrix built yet" fallback. `n_cols: 1` is correct by design for the case it's meant to handle. Phase 4's column loop is safe as planned — this was worth checking once, doesn't need further action.
+105
View File
@@ -0,0 +1,105 @@
# Rebuild / filter — column-first design
## Problem with the current two-pass design
`rebuild_partition` currently makes **two full passes** over source data:
**Pass 1** — read unitigs → MPHF lookup (source) → read row (108 values) → apply filter → push kmer into `GraphDeBruijn`, **discard row**.
**Pass 2** — read unitigs again → MPHF lookup again → read row again → for each passing kmer, look up slot in new MPHF → fill column builders.
Both passes do random access into the source matrix: for each kmer, the MPHF returns a slot, then we read 108 values scattered across 108 column positions. This is cache-hostile even with a packed matrix (`.pbmx`), because the matrix is column-major: consecutive row reads jump across the file.
## Memory budget
The `keep` bitvector costs **1 bit per slot**. With 256 partitions and realistic kmer counts, each partition holds at most a few tens of millions of slots → a few MB per bitvector. Even in the absolute worst case (800 M slots), it stays under 100 MB. This is negligible.
The `slot_map` option (Option B, 8–16 bytes per slot) is heavier but still bounded: at 15 M slots and 8 bytes, that is 120 MB per partition, acceptable for a single worker.
## Key observation
**The filter operates on column values, not on kmers.** A filter like `--max-outgroup-count 0` only needs to know, for each slot, whether any outgroup column is non-zero. It does not need to know which kmer occupies that slot.
This means filtering can be done as a **sequential column scan** that produces a `keep: BitVec[n_slots]` — no MPHF lookups, no kmer knowledge, perfectly cache-friendly.
## Proposed single-scan design
### Step 1 — column scan → `keep` bitvector
```
for each column c in source matrix:
read column c sequentially (one mmap range)
update keep[slot] according to filter contribution of column c
```
For `GroupQuorumFilter` with ingroup/outgroup:
- ingroup columns: count presence per slot → `ingroup_count[slot]`
- outgroup columns: `keep[slot] &= (value[slot] == 0)` (early-exit possible)
Result: `keep: BitVec` of size `n_slots`, computed with purely sequential IO.
### Step 2 — unitig scan → kept kmers + new MPHF
```
for each kmer in unitig files:
old_slot = old_MPHF(kmer)
if keep[old_slot]:
push kmer into new GraphDeBruijn
record (old_slot, kmer) ← or just old_slot in order
```
Build new MPHF from `GraphDeBruijn` via `materialize_layer`.
### Step 3 — fill new matrix
Two sub-options:
**Option A — from recorded (old_slot, kmer) pairs:**
```
for each (old_slot, kmer) in recorded list:
new_slot = new_MPHF(kmer)
for each column c:
new_matrix[new_slot, c] = old_matrix[old_slot, c]
```
Memory cost: `n_kept × (8 + 8)` bytes for `(old_slot: usize, kmer: CanonicalKmer)`.
For species-specific filters, `n_kept` is small. For unfiltered rebuild, `n_kept = n_slots`.
**Option B — column-by-column copy using old→new slot mapping:**
Precompute `slot_map: Vec<Option<usize>>` of size `n_slots`:
- For each kmer in unitig file: `slot_map[old_MPHF(kmer)] = Some(new_MPHF(kmer))`
Then for each source column:
```
read source column sequentially
for each slot where slot_map[slot] = Some(new_slot):
write value to new column at new_slot
```
Memory cost: `n_slots × sizeof(usize)` for the slot map (one usize per source slot).
IO pattern: sequential read of each source column → random write into new column builders.
Option B avoids storing kmer values and works uniformly regardless of filter selectivity.
## Comparison
| | Current | Proposed |
|---|---|---|
| Disk reads | 2× unitigs + 2× random matrix | 1× columns (sequential) + 1× unitigs |
| MPHF lookups (source) | 2× N_kmers | 1× N_kept (step 2) or 0 (option B, col scan only) |
| Cache behavior | poor (random row access) | good (sequential column scan) |
| Extra memory | none | slot_map (option B) or (old_slot, kmer) list (option A) |
## Files to modify
- `src/obikpartitionner/src/rebuild_layer.rs` — `rebuild_partition` and `iter_src_layers`
- Possibly `src/obicompactvec/` — add column iterator API if not already present
- `src/obilayeredmap/` — check if per-column sequential access is exposed on `SrcLayerData`
## Open questions
- Does `SrcLayerData` expose per-column sequential iteration, or only `lookup(kmer, n_genomes)` random access?
- For option B: are new column builders writable in random-slot order (i.e. `set_val(slot, value)` without sequential constraint)?
- For `GroupQuorumFilter` specifically: can the filter be decomposed into independent per-column contributions, or does it need the full row?
+35 -1
View File
@@ -1,6 +1,24 @@
# Chunk reader — implementation
The `obiread` crate provides a streaming iterator that reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. Chunks are consumed in parallel by downstream workers.
`obiread` exposes two distinct sequence reading paths, each optimised for a different use case.
## Two reading paths
| Path | API | Output unit | Per-record identity | Use case |
|------|-----|-------------|---------------------|----------|
| **Record path** | `read_sequence_chunks` → `parse_chunk` | `SeqRecord` (id + raw sequence + normalised rope) | yes | `query` — must read complete records |
| **Stream path** | `open_nuc_stream` | `NucPage` (flat normalised byte buffer) | no | `index`, `superkmer` — bulk throughput |
The record path uses `Rope`-backed chunks and is described in detail below.
The stream path (`NucStream` / `NucPage`) is described in the scatter section of [pipeline](pipeline.md).
---
## Record path: chunk reader
The chunk reader reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. `parse_chunk` then converts each chunk into a `Vec<SeqRecord>`, where each record carries its identifier, raw sequence bytes, and a normalised rope ready for superkmer building.
This path is mandatory for `query`, where superkmers must be tracked back to their originating sequence (id, kmer offset) for output annotation.
## Output type: Rope
@@ -89,3 +107,19 @@ stateDiagram-v2
`restart` is updated each time a `+` is found. When any state fails its expected input, the scan jumps back to `restart` and continues from there — guaranteeing that a `@` in a quality line cannot be accepted as a record start, because the `\n+\n` structure immediately following it (going backward) will not be found.
Returns the byte offset of the `@` that starts the last complete record.
---
## Future work — parallel gzip decompression in `xopen`
`obiread::xopen` (`xopen.rs`) decompresses gzip via `niffler` → `flate2`, which is single-threaded (standard DEFLATE has no parallel-decodable structure). For large local gzip inputs this single-threaded decompression can become the throughput bottleneck feeding the `query`/`index`/`superkmer` pipelines, since chunk/page production for a given file is serialized ahead of the worker pool.
Candidate: special-case local, on-disk, gzip-magic-detected paths in `open_raw`/`xopen` to use [`rapidgzip-rs`](https://github.com/alekseizarubin/rapidgzip-rs) (`ReaderBuilder::new().parallelism(n).open(path)`, implements `Read + Seek`) instead of `niffler`, keeping `niffler` for every other case: `stdin` (`-`), HTTP(S) sources, and all non-gzip formats (bzip2, xz, zstd — less used in practice here).
Constraints identified so far (not yet validated against real data):
- Branch point must move earlier than the current `decompress()` call in `open_raw` — rapidgzip's fast path needs the file **path**, not an already-opened generic `Read`, so the gzip/local-file detection has to happen before the generic `File::open` + `niffler::send::get_reader` path is taken.
- `stdin` and HTTP sources are not seekable — they stay on `niffler` regardless; the gain only applies to local on-disk `.gz` files.
- `rapidgzip-sys` vendors a native C++ engine: requires CMake ≥ 3.17, a C++17 compiler, and `nasm` on x86 targets — a real build-toolchain addition, not just a pure-Rust crate.
- Low maturity of the Rust binding at review time (2 GitHub stars, ~15 commits, April 2026 latest release) — the underlying C++ engine is validated (HPDC 2023 paper), but the binding itself has limited production track record.
Decision: parked for now. Before adopting, validate on real data: throughput vs. `niffler` on representative large `.gz` inputs, and byte-for-byte correctness of decompressed output.
+13 -10
View File
@@ -35,15 +35,18 @@ stored at `s` belongs to the legitimate k-mer at that slot. The FP event is:
P(FP per k-mer) = 1 / 2^b
```
The Findere trick raises the effective window to z consecutive k-mers. A query
succeeds only when all z fingerprint checks pass, reducing the per-window FP rate:
The Findere trick reduces the indexed k-mer size. When the user specifies k_user
and z, the index physically stores k-mers of size `s = k_user − z + 1`. At query
time, the same s-mer size is used. After collecting per-position s-mer results
over the full query sequence, a sliding window of size z aggregates z consecutive
s-mer hits into one confirmed k_user-mer hit, reducing the per-window FP rate:
```
P(FP per z-window) = 1 / 2^(b·z)
P(FP per k_user-mer) = 1 / 2^(b·z)
```
The effective indexed k-mer length is `k − z + 1`: a query for a (k+z−1)-mer
decomposes into z overlapping k-mers, all of which must match.
`IndexConfig::kmer_size` stores `s = k_user − z + 1`, not k_user. Both indexing
and querying use this stored size via `set_k(idx.kmer_size())`.
Parameters b and z are stored in `layer_meta.json` (`EvidenceKind::Approx { b, z }`).
@@ -167,12 +170,12 @@ any index. It accepts the same `--evidence-bits`, `-z`, and `--fp` flags and
additionally accepts `-k` to display the effective indexed k-mer length:
```
k (query): 31
k (indexed): 31
z: 1
k (user): 31
k (indexed, s=k-z+1): 27
z: 5
evidence bits (b): 8
FP per k-mer: 3.906e-3 (1/2^8)
FP per z-window: 3.906e-3 (1/2^8)
FP per s-mer: 3.906e-3 (1/2^8)
FP per k-mer window: 9.537e-7 (1/2^(8·5))
```
Useful for choosing parameters before committing to an index build.
+279
View File
@@ -0,0 +1,279 @@
# Kmer filtering and ingroup/outgroup predicates
The `filter`, `dump`, and `unitig` commands share the same filtering system,
implemented as a shared `FilterArgs` clap argument group embedded in each command
via `#[command(flatten)]`. Filters select k-mers based on per-genome quorum
counts, optionally restricted to **ingroup** and **outgroup** genome sets derived
from genome metadata. All rules described here apply identically to all three commands.
`filter` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical concept paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
Stored taxonomy values always start with `/` (the root of the path).
Query patterns do **not** need to start with `/` — a leading `/` is an optional
start anchor, not a requirement.
| Pattern form | Semantics |
|---|---|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B |
| `A/B$` | value ends with A then B |
| `/A/B$` | value is exactly A then B |
| `A@x/B` | A with class `x` followed by B with any class |
- `taxon~/Betulaceae/Betula` matches any path that starts with `Betulaceae` then `Betula`.
- `taxon~Betula` matches any path containing `Betula` as a segment, anywhere.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)` → `in_result`
2. Evaluate `OR(outgroup predicates)` → `out_result`
3. If `in_result = true` → **Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true` → **Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
> **Rule**: declaring a group activates the smart default **only if no quorum flag for that group is explicitly set**.
> As soon as any quorum flag for a group is present on the command line, all defaults for that group revert to no-op values.
| `--ingroup` | Any ingroup quorum flag? | `--min-frac` default |
|-------------|--------------------------|----------------------|
| not set | — | 0.0 (no-op) |
| set | no | **1.0** — all ingroup genomes must carry the k-mer |
| set | yes | 0.0 — user controls quorum explicitly |
| `--outgroup` | Any outgroup quorum flag? | `--max-outgroup-count` default |
|--------------|---------------------------|-------------------------------|
| not set | — | outgroup size (no-op) |
| set | no | **0** — no outgroup genome may carry the k-mer |
| set | yes | outgroup size — user controls quorum explicitly |
"Any ingroup quorum flag" means any of: `--min-count`, `--max-count`, `--min-frac`, `--max-frac`.
"Any outgroup quorum flag" means any of: `--min-outgroup-count`, `--max-outgroup-count`, `--min-outgroup-frac`, `--max-outgroup-frac`.
**Why this rule?** Setting any quorum flag signals explicit intent — the defaults are there to help when the user omits quorum entirely, not to interfere with deliberate constraints. Mixing implicit and explicit quorum on the same group would risk silent incoherence (e.g. `--max-count 0` with an implicit `--min-frac 1.0`).
All other bounds default to 0 / group size / 0.0 / 1.0 regardless of whether groups are declared.
### Validation
After resolving defaults, the following are checked and cause an immediate error:
| Condition | Error |
|-----------|-------|
| `--min-count > --max-count` | incoherent bounds |
| `--min-frac > --max-frac` | incoherent bounds |
| `--min-outgroup-count > --max-outgroup-count` | incoherent bounds |
| `--min-outgroup-frac > --max-outgroup-frac` | incoherent bounds |
| any fraction outside `[0.0, 1.0]` | invalid value |
The check applies to the **effective** values (after defaults are resolved), so an explicit `--max-frac 0.5` with an implicit `--min-frac 1.0` would have been caught — but the rule above prevents that situation from arising in the first place.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
### Conservative rounding of fraction thresholds
When a fraction threshold `F` is applied to a group of size `N`, the effective
integer threshold is determined by the direction of the bound:
| Bound | Effective count | Rounding | Rationale |
|-------|----------------|----------|-----------|
| `--min-frac F` | k-mer in ≥ ⌈F·N⌉ genomes | **ceil** | stricter — a kmer present in exactly ⌊F·N⌋ genomes does not meet the fraction |
| `--max-frac F` | k-mer in ≤ ⌊F·N⌋ genomes | **floor** | stricter — a kmer present in ⌈F·N⌉ genomes already exceeds the fraction |
The same rule applies symmetrically to `--min-outgroup-frac` (ceil) and
`--max-outgroup-frac` (floor). The outgroup direction is not inverted: the
conservative rounding depends only on whether the bound is a minimum or a
maximum, not on which group it applies to.
**Example** — `--min-frac 0.5` with an ingroup of 3 genomes:
`⌈0.5 × 3⌉ = ⌈1.5⌉ = 2` → at least 2 of 3 ingroup genomes must carry the k-mer.
**Implementation note** — the filter evaluates `n / denom < min_frac` directly
(integer `n`, float comparison) rather than pre-computing `⌈F·N⌉`. This is
mathematically equivalent for integer counts: `n / N < F` ↔ `n < F·N` ↔
`n ≤ ⌈F·N⌉ − 1` ↔ `n < ⌈F·N⌉`. No explicit rounding is needed.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer filter src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
To dump only k-mers specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Command-specific options
### `dump --head N`
Stops output after the first N k-mers that pass all active filters.
Iteration terminates immediately — subsequent partitions and layers are not scanned.
Useful for quick inspection of large indexes without loading the entire dataset.
```sh
obikmer dump myindex --head 100
obikmer dump myindex --head 20 --ingroup "species=Betula_nana" --min-count 1
```
### `distance --presence-threshold N`
When computing Jaccard distance on a **count index**, a k-mer is considered present in a genome if its count is ≥ N (default 1).
This option is independent of the `--presence-threshold` used in filtering.
```sh
# Jaccard treating kmers with count ≥ 2 as present
obikmer distance myindex --metric jaccard --presence-threshold 2
```
This parameter has no effect on presence/absence indexes (where values are already 0/1) or on metrics other than Jaccard.
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `FilterArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `filter`, `dump`, and `unitig` all go through this single
entry point.
+207
View File
@@ -0,0 +1,207 @@
# Merge parallelism and memory pressure
## Problem observed
Running `obikmer merge` over 109 indexes (108 sources + 1 bootstrap) on a 192-core machine
produces a fatal OOM during the `merge_partitions` stage:
```
memory allocation of 9126805520 bytes failed
```
A single allocation of ~8.5 GB fails. This is not an aggregate; it is one `malloc` call
from hashbrown during a HashMap resize.
---
## Root cause
### The merge pipeline per partition
```
source unitigs.bin
→ iter_indexed_canonical_kmers()
→ GraphDeBruijn::push() ← HashSet<u64> + 1 byte flags, all in RAM
→ compute_degrees_and_mark_starts()
→ try_for_each_unitig()
→ unitigs.bin (new layer)
→ Layer::build() → MPHF + evidence
```
`GraphDeBruijn` is a `FastHashMap<CanonicalKmer, AtomicU8>` — a `HashSet<u64>` with
one flag byte per node. Neighbor lookup is implicit: 4 probes into the same map.
No edges are stored. The full kmer set of one partition must reside in RAM
simultaneously to compute degrees and mark unitig starts.
The matrix builders that follow (pass 2) are mmapped files — they do **not** consume
significant RAM. The pressure is entirely in pass 1.
### Unbounded Rayon parallelism
With 192 cores, Rayon ran up to 192 partitions concurrently. Each partition built its
own `GraphDeBruijn` accumulating all kmers absent from the destination. Peak memory =
192 × peak_partition_hashset.
### The 8.5 GB single allocation
hashbrown allocates the entire backing array in one call when rehashing.
At load factor 7/8: `capacity × (sizeof(K,V) + 1 control byte)`.
For `(u64, AtomicU8)` with alignment: ~16 bytes per slot.
```
9 127 MB / 16 bytes ≈ 570 M slots → ~380 M new kmers in one partition
```
Plausible for the largest partition of 108 Salix/Betula sources (~450 Mbp each).
---
## Partition size distribution
`obikmer utils --partition-stats` measures the sum of `unitigs.bin` file sizes
per partition across all source indexes (pure `stat()` syscalls, negligible cost).
Observed on a 9-genome pilot (256 partitions):
| Stat | Value |
|---|---|
| min | 30.5 MB |
| max | 232.1 MB |
| mean | 40.1 MB |
| median | 37.2 MB |
| p95 | 47.1 MB |
| max/median ratio | 6.23× |
The distribution is **bimodal with a heavy tail**:
- 238/256 partitions in a narrow 30–50 MB band
- 4 structurally extreme partitions (3–6× the median): 221, 233, 135, 191
These correspond to minimizers over-represented in repetitive regions shared across
all sources. They are extreme in every run on this dataset.
With 109 sources, outlier partitions do not scale linearly: only kmers **absent from
the destination** enter the GraphDeBruijn, and inter-source overlap is high for closely
related species. Partition 221 is the likely trigger for the 8.5 GB crash.
---
## Solution: LFD scheduling + memory budget semaphore
### Principle
Pre-sort partitions by **decreasing estimated size** (First Fit Decreasing — FFD),
then schedule them through a **continuous memory budget semaphore**. Each worker
acquires an estimated cost before starting and releases it on completion.
Large partitions run first when the full budget is available; small partitions fill
the gaps. No hard outlier threshold is needed.
### `MemoryBudget` (`obisys`)
```rust
pub struct MemoryBudget { … }
impl MemoryBudget {
pub fn new(total: u64) -> Self;
pub fn acquire(&self, cost: u64); // blocks until budget available
pub fn release(&self, cost: u64);
pub fn peak_active(&self) -> usize;
}
```
Non-deadlock guarantee: when `active == 0`, acquire always succeeds regardless of cost.
Without this, a partition whose estimated cost exceeds the total budget would block forever.
### Adaptive expansion factor
The expansion factor converts raw `unitigs.bin` bytes into an estimated GraphDeBruijn
RAM footprint. hashbrown stores each kmer as `(u64, AtomicU8)` ≈ 16 bytes/kmer at 7/8
load factor; unitig files encode ≈ 2 bits/base. The ratio depends on average unitig
length (short unitigs: ~2×; long unitigs: up to ~50×).
**Phase 1 — sequential pilot (worst partition)**
The largest partition runs alone first. Its actual `g.len()` seeds the expansion factor
before any parallel job starts. `FALLBACK_EXPANSION = 4×` is used only for empty partitions.
```rust
let worst_g_len = dst_partition.merge_partition(worst_id, …)?;
// ↑ now returns SKResult<usize> (was SKResult<()>)
let seed_expansion = worst_g_len as u64 * 16 * 1000 / worst_bytes;
let max_expansion = AtomicU64::new(seed_expansion);
```
**Phase 2 — parallel with adaptive updates**
```rust
order[1..].into_par_iter().for_each(|&i| {
let cost = partition_sizes[i] * max_expansion.load(Relaxed) / 1000;
budget.acquire(cost);
let g_len = dst_partition.merge_partition(i, …)?;
budget.release(cost); // releases estimated cost, not actual
let actual = g_len as u64 * 16 * 1000 / partition_sizes[i];
max_expansion.fetch_max(actual, Relaxed); // always pessimistic (max)
});
```
`budget.release(cost)` uses the estimated cost, not the actual one. The budget tracks
reservations, not physical RAM; each partition pays what it promised at acquisition.
**On the safety margin**
There is no separate multiplier `k`. It is redundant with `budget_fraction`: both
reduce effective concurrency by the same amount. A single parameter is easier to
calibrate. `budget_fraction = 0.5` (default) reserves half of available RAM for the
OS, MPHF build, pass 2, and estimation error.
`--budget-fraction` is exposed as a CLI flag — the only escape hatch for pathological
cases (extreme repetitive content, unusually long unitigs) that still cause OOM.
### RAM source
`obisys::available_memory_bytes()` — wraps `sysinfo::System::available_memory()`,
falls back to `total / 2` on macOS when the memory compressor returns 0.
---
## Diagnostic report
After the parallel phase, `merge_partition` emits a structured report via `tracing::info!`:
```
─── merge_partitions memory report ───
available RAM : 512.0 GB budget 50% = 256.0 GB
expansion factor — seed: 4.2× final max: 6.1× (mean: 1.8× median: 1.6×)
peak concurrent workers: 42
expansion factor distribution (256 partitions with data):
0.50× – 1.25× │██████████████████████████████ 148
1.25× – 2.00× │████████████████████████ 82
…
5.50× – 6.25× │█ 2
top partitions by actual expansion factor:
partition 221 : 6.10× (232.1 MB unitigs → 48M kmers, reserved at 4.20×)
partition 135 : 5.82× (127.3 MB unitigs → 24M kmers, reserved at 4.20×)
…
──────────────────────────────────────
```
Fields useful for diagnosis:
| Field | Interpretation |
|---|---|
| `seed` vs `final max` expansion | gap indicates partitions with higher expansion than the worst-by-size |
| `reserved at X×` | the factor used at acquisition; if much lower than actual, the budget was under-reserved for that partition |
| `peak concurrent workers` | effective parallelism achieved under the budget constraint |
| `mean` / `median` expansion | typical dataset characteristic; stable across runs on the same data |
---
## Parameters
| Parameter | Default | CLI flag | Notes |
|---|---|---|---|
| `fallback_expansion` | 4× | — | seed for empty partitions only |
| `budget_fraction` | 0.5 | `--budget-fraction` | reduce if OOM persists |
| RAM source | `obisys::available_memory_bytes()` | — | falls back to `total/2` on macOS |
+520
View File
@@ -0,0 +1,520 @@
# obicompactvec — Complete Reference
## Module structure
```
src/obicompactvec/src/
lib.rs public re-exports
views.rs BitSliceView<'a>, IntSliceView<'a> — zero-copy read views
traits.rs ColumnWeights, CountPartials, BitPartials (matrix aggregation)
bitvec.rs PersistentBitVec, PersistentBitVecBuilder, BitIter
reader.rs PersistentCompactIntVec (read-only)
builder.rs PersistentCompactIntVecBuilder (read-write)
tempintvec.rs TempCompactIntVec, TempCompactIntVecBuilder (temp-file-backed)
tempbitvec.rs TempBitVec, TempBitVecBuilder (temp-file-backed)
bitmatrix.rs PersistentBitMatrix, PersistentBitMatrixBuilder
intmatrix.rs PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder
colgroup.rs ColGroup, MatrixGroupOps trait
format.rs file format constants, encode/decode helpers
layer_meta.rs LayerMeta (column metadata)
meta.rs matrix metadata
```
```mermaid
graph TD
views --> bitvec
views --> builder
views --> tempbitvec
views --> tempintvec
views --> bitmatrix
views --> intmatrix
format --> reader
format --> builder
reader --> intmatrix
reader --> tempintvec
builder --> intmatrix
builder --> tempintvec
bitvec --> tempbitvec
bitvec --> bitmatrix
tempintvec --> intmatrix
tempintvec --> bitmatrix
tempbitvec --> intmatrix
tempbitvec --> bitmatrix
colgroup --> intmatrix
colgroup --> bitmatrix
layer_meta --> bitmatrix
layer_meta --> intmatrix
meta --> bitmatrix
meta --> intmatrix
```
---
## Compact int encoding
All integer vectors use the same two-tier encoding regardless of storage backend.
**Primary array** — one `u8` per slot:
- Values **0–254** are stored directly. No overhead.
- Value **255 is a sentinel**: the slot's actual value is ≥ 255 and lives in the overflow store.
**Overflow store** — maps slot index to a `u32` value ≥ 255:
- In `PersistentCompactIntVecBuilder`: a `HashMap<usize, u32>` in RAM.
- In `PersistentCompactIntVec` (reader): a sorted `[(slot: u64, value: u32)]` array in the mmap, with a sparse L1-resident index for binary search.
```mermaid
flowchart LR
slot --> P["primary[slot]: u8"]
P -->|"< 255"| V["value = byte (0–254)"]
P -->|"= 255 sentinel"| OV["overflow store"]
OV -->|"Builder"| HM["HashMap&lt;usize, u32&gt;\nin RAM"]
OV -->|"PersistentCompactIntVec"| SA["sorted [(slot,value)] in mmap\n+ sparse L1 index"]
```
**Key property — sentinel 255 = +∞ on `u8`:**
- `min(a, 255) = a` for all `a ≤ 254` → correct when only one side is overflow
- `max(a, 255) = 255` → correct sentinel when either side is overflow
- Only the **both-overflow** case requires reading actual values from the overflow store.
In practice, k (overflow count) ≪ n (total slots). Observed genomic data: ~0.07% of kmer slots are in overflow.
---
## View types
The previous trait hierarchy (`BitSlice`, `BitSliceMut`, `IntSlice`, `IntSliceMut`) has been replaced by two concrete zero-copy view structs with inherent methods. Views are **`Copy`** — passing them is free. All read operations live on these two types.
### `BitSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct BitSliceView<'a> { pub(crate) words: &'a [u64], pub(crate) n: usize }
```
Bit `i` is at `words[i >> 6]` bit `i & 63` (LSB-first). Padding bits in the last word are zero.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `get(slot)` | O(1) |
| `count_ones()` | POPCNT per word, O(n/64) |
| `count_zeros()` | `n − count_ones()`, O(n/64) |
| `iter() -> BitSliceIter<'a>` | O(1) setup, O(n) iteration |
| `partial_jaccard_dist(other: BitSliceView)` | `(a&b).popcount`, `(a\|b).popcount` per word, O(n/64) |
| `jaccard_dist(other: BitSliceView)` | from partial, O(n/64) |
| `hamming_dist(other: BitSliceView)` | `(a^b).popcount` per word, O(n/64) |
`BitSliceIter<'a>`: word-level scan; one word per 64 iterations.
### `IntSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct IntSliceView<'a> {
pub(crate) primary: &'a [u8],
pub(crate) overflow_raw: &'a [u8], // sorted [(slot:u64, value:u32)] entries
pub(crate) n_overflow: usize,
pub(crate) n: usize,
}
```
`overflow_raw` contains `n_overflow` entries of `OVERFLOW_ENTRY_SIZE` bytes each, sorted by slot. The sort invariant is established at `close()`/`freeze()` time.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `primary_bytes()` | O(1) |
| `overflow_entries() -> impl Iterator<(usize,u32)>` | O(n_overflow) iteration |
| `get(slot)` | O(1) primary; binary search O(log k) for overflow slots |
| `iter() -> IntSliceViewIter<'a>` | merge scan, O(n + k) |
| `sum()` | byte scan + overflow, O(n + k) |
| `count_nonzero()` | byte scan, O(n) |
| Distance methods (`bray_dist`, `euclidean_dist`, `jaccard_dist`, …) | O(n + k) |
`IntSliceViewIter<'a>`: merge scan using `overflow_pos` index. Requires sorted overflow — guaranteed by the construction lifecycle.
**Builder `view()` vs reader `view()`:** `PersistentCompactIntVecBuilder` stores overflow as an unsorted `HashMap`, not raw bytes. Its `view()` returns an `IntSliceView` with `overflow_raw = &[]` and `n_overflow = 0`. This is intentional — the view is primarily useful after `freeze()`. During building, callers that need overflow use `overflow_entries()` directly.
---
## Concrete types
```mermaid
classDiagram
class BitSliceView {
+words: &[u64]
+n: usize
+get(slot) bool
+count_ones() u64
+iter() BitSliceIter
+jaccard_dist/hamming_dist(other: BitSliceView)
}
class IntSliceView {
+primary: &[u8]
+overflow_raw: &[u8]
+n_overflow: usize
+n: usize
+get(slot) u32
+iter() IntSliceViewIter
+overflow_entries() Iterator
+bray_dist/euclidean_dist/…(other: IntSliceView)
}
class PersistentBitVec {
-mmap: Mmap
-n: usize
+view() BitSliceView
+get(slot) bool
+count_ones/zeros() u64
+iter() BitIter
+partial_jaccard_dist(&Self) (u64,u64)
+jaccard_dist/hamming_dist(&Self) …
}
class PersistentBitVecBuilder {
-mmap: MmapMut
-n: usize
+view() BitSliceView
+set(slot, bool)
+or/and/xor/not(BitSliceView)
+copy_from(BitSliceView)
+close() / finish() → PersistentBitVec
}
class PersistentCompactIntVec {
-mmap: Mmap
-n: usize
-n_overflow: usize
-step: usize
-index: Vec~(usize,usize)~
+view() IntSliceView
+get(slot) u32
+iter() Iter
+sum/count_nonzero() u64
+bray_dist/euclidean_dist/… (&Self)
}
class PersistentCompactIntVecBuilder {
-mmap: MmapMut
-n: usize
-overflow: HashMap~usize,u32~
+view() IntSliceView
+set(slot, u32) / get(slot) u32
+inc / inc_present / inc_present_fast
+inc_predicate / inc_predicate_fast
+add/min/max/diff/mask_with(…View)
+primary_bytes/primary_bytes_mut()
+close() / finish() → PersistentCompactIntVec
}
PersistentBitVec --> BitSliceView : view()
PersistentBitVecBuilder --> BitSliceView : view()
PersistentCompactIntVec --> IntSliceView : view()
PersistentCompactIntVecBuilder --> IntSliceView : view() (primary only)
PersistentBitVecBuilder --> PersistentBitVec : close() then open()
PersistentCompactIntVecBuilder --> PersistentCompactIntVec : close() then open()
```
### `PersistentBitVec` / `PersistentBitVecBuilder`
`PersistentBitVec` is the read-only type. `view()` returns a `BitSliceView<'_>` over the mmap word array. Direct inherent methods delegate to the view: `count_ones()`, `count_zeros()`, `partial_jaccard_dist(&Self)`, `jaccard_dist(&Self)`, `hamming_dist(&Self)`.
`BitIter<'a>` — exported iterator for `PersistentBitVec::iter()`:
```rust
pub struct BitIter<'a> { pub(crate) words: &'a [u64], pub(crate) slot: usize, pub(crate) n: usize }
```
`PersistentBitVecBuilder` is the read-write type. Mutation operations accept `BitSliceView<'_>`:
| Method | Cost |
|---|---|
| `set(slot, bool)` | O(1) |
| `view() -> BitSliceView<'_>` | O(1) |
| `or/and/xor(BitSliceView)` | word-level, O(n/64), SIMD-friendly |
| `not()` | `w ^= u64::MAX` per word, re-masks last word | O(n/64) |
| `copy_from(BitSliceView)` | `copy_from_slice` | O(n/64) |
### `PersistentCompactIntVec` / `PersistentCompactIntVecBuilder`
`PersistentCompactIntVec` is the read-only type. `view()` returns an `IntSliceView<'_>` over the mmap primary and overflow arrays. Inherent `iter()` is a merge scan (`Iter` struct). Inherent `sum()` and `count_nonzero()` use fast byte-scan helpers.
`PersistentCompactIntVecBuilder` is the read-write type. Mutation methods on the builder fall into two categories:
**Point mutations:**
| Method | Note |
|---|---|
| `set(slot, u32)` | writes primary[slot] or 255+overflow |
| `get(slot) -> u32` | reads primary byte or HashMap |
| `inc(slot)` | `get` + `set`, O(1) |
**Bulk computation methods** — accept view arguments:
| Method | Semantics | Overflow |
|---|---|---|
| `inc_present(BitSliceView)` | `+= 1` at each 1-bit | via `inc`, safe for any group size |
| `inc_present_fast(BitSliceView)` | same, raw u8 `+= 1` | `debug_assert` no 255 reached |
| `inc_predicate(IntSliceView, pred)` | `+= 1` where `pred(col[s])` | two-pass, safe |
| `inc_predicate_fast(IntSliceView, pred)` | same, raw u8 | `debug_assert` no 255 reached |
| `add(IntSliceView)` | `self[s] += other[s]` | primary fast path + overflow fallback |
| `min(IntSliceView)` | byte min + both-overflow fixup | see algorithm below |
| `max(IntSliceView)` | pre-pass + byte max | see algorithm below |
| `diff(IntSliceView)` | saturating sub | self<255 hot path |
| `mask_with(BitSliceView)` | zeros slots where mask bit = 0 | O(n_zeros) |
**`inc_present_fast` / `inc_predicate_fast` invariant:** caller guarantees no counter reaches 255 during the operation (group size < 255 for `inc_present_fast`, or chunk size < 255 for `inc_predicate_fast`). Violation is caught by `debug_assert` in dev builds.
**`min` algorithm:**
Exploits 255 = +∞: byte-level min is correct unless both sides are overflow.
```
snapshot self_ov: Vec<(slot,val)>
snapshot other_ov: HashMap<slot,val>
clear_overflow()
Pass 1 — byte min, SIMD-vectorizable, O(n)
Pass 2 — both-overflow fixup, O(k_self):
for (slot, self_val) in self_ov:
if slot ∈ other_ov: set(slot, min(self_val, other_ov[slot]))
```
**`max` algorithm:**
Cannot do byte max first — `max(255, b<255)=255` overwrites self's original overflow value. Pre-pass reads self's value at other's overflow slots before the byte pass.
```
Pre-pass O(k_other): for (slot, other_val) in other.overflow_entries():
set(slot, max(self.get(slot), other_val))
Pass 1 — byte max, SIMD-vectorizable, O(n)
```
---
## Matrix types
Four matrix types, two encodings × two formats:
| | Columnar format | Packed format |
|---|---|---|
| **Bit** | `PersistentBitMatrix` (Columnar variant) | `PersistentBitMatrix` (Packed variant) |
| **Int** | `PersistentCompactIntMatrix` (Columnar variant) | `PersistentCompactIntMatrix` (Packed variant) |
Both matrix types are enums (`Columnar` / `Packed` / `Implicit` for bit) behind a transparent API. `col_view(c)` returns the appropriate view directly:
```rust
// PersistentBitMatrix
pub fn col_view(&self, c: usize) -> BitSliceView<'_>
// PersistentCompactIntMatrix
pub fn col_view(&self, c: usize) -> IntSliceView<'_>
```
No wrapper enums (`BitColView`, `IntColView`): the caller receives a `Copy` view struct immediately usable with any view method or bulk builder method.
`pack_compact_int_matrix` and `pack_bit_matrix` convert columnar → packed format.
---
## Aggregation traits (matrix level)
### ColumnWeights
```rust
trait ColumnWeights: Send + Sync {
fn col_weights(&self) -> Array1<u64>; // sum per column
fn partial_kmer_counts(&self) -> Array1<u64>; // default = col_weights()
}
```
`partial_kmer_counts` is overridden for count matrices to return `count_nonzero` per column (distinct kmers) rather than total count.
### CountPartials
Abstract required methods: `partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`, `partial_relfreq_bray`, `partial_relfreq_euclidean`, `partial_hellinger`.
**Additivity rule:** self-contained partials (`partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`) can be element-wise summed across all `(partition, layer)` pairs. Normalised partials (`partial_relfreq_*`, `partial_hellinger`) require the **global** `col_weights` (accumulated across all layers and all partitions) as parameter.
**`partial_threshold_jaccard` returns `(inter, union)`** because `union[i,j]` depends on both columns simultaneously.
Provided finalisations:
| Finalisation | Formula |
|---|---|
| `bray_dist_matrix()` | `1 − 2·partial_bray[i,j] / (w[i] + w[j])` |
| `euclidean_dist_matrix()` | `√partial_euclidean[i,j]` |
| `threshold_jaccard_dist_matrix(t)` | `1 − inter[i,j] / union[i,j]` |
| `relfreq_bray_dist_matrix()` | `1 − partial_relfreq_bray[i,j]` |
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
---
## Temp-file-backed types
**All inter-function results use temp-file-backed types** so the OS can page them out under memory pressure. This matters in practice: processing dozens of layers × hundreds of partitions in parallel would otherwise accumulate gigabytes of live anonymous memory.
### Lifecycle
```
TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
↓ (inc_present_fast / inc_predicate_fast / add / mask_with / …)
.freeze() → TempCompactIntVec (read-only mmap + TempDir)
↓ (optional)
.make_persistent(path) → PersistentCompactIntVec (permanent file)
```
Same pattern for `TempBitVecBuilder` → `TempBitVec` → `PersistentBitVec`.
**Drop order**: `TempCompactIntVec { vec: PersistentCompactIntVec, _temp: TempDir }` — Rust drops fields in declaration order. `vec` (mmap) released before `_temp` (directory deleted). No explicit `drop()` needed.
### TempCompactIntVec / TempCompactIntVecBuilder
```rust
pub struct TempCompactIntVec {
vec: PersistentCompactIntVec,
_temp: TempDir, // dropped after vec
}
pub(crate) struct TempCompactIntVecBuilder {
builder: PersistentCompactIntVecBuilder,
temp: TempDir,
}
```
`TempCompactIntVec`: read access via `get(slot)`, `sum()`, `iter()`, `view() -> IntSliceView<'_>`.
`TempCompactIntVecBuilder`: full delegation to inner `PersistentCompactIntVecBuilder` — all bulk computation methods (`inc_present_fast`, `inc_predicate_fast`, `add`, `min`, `max`, `diff`, `mask_with`) are exposed as `pub(crate)`.
### TempBitVec / TempBitVecBuilder
```rust
pub struct TempBitVec {
vec: PersistentBitVec,
_temp: TempDir,
}
pub(crate) struct TempBitVecBuilder {
builder: PersistentBitVecBuilder,
temp: TempDir,
}
```
`TempBitVec`: read access via `get(slot)`, `count_ones()`, `view() -> BitSliceView<'_>`, `iter()`.
`TempBitVecBuilder`: exposes `set(slot, bool)`, `or(BitSliceView)`, and:
```rust
pub(crate) fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool)
```
`or_where` — two passes, no intermediate allocation:
```
Pass 1 — primary bytes, O(n):
for slot in 0..n:
b = col.primary_bytes()[slot]
if b < 255 AND pred(b as u32): self.set(slot, true)
Pass 2 — overflow, O(k):
for (slot, val) in col.overflow_entries():
if pred(val): self.set(slot, true)
```
---
## Filter / Select API
### ColGroup
```rust
pub struct ColGroup { pub name: String, pub indices: Vec<usize> }
```
Defined **once at the index level** from column metadata. Valid in all matrices of all layers and partitions — column structure is identical across the entire hierarchy; only rows (kmer slots) are partitioned.
### Composition axis
- **Across partitions**: kmer space is partitioned → partial results **concatenated** (disjoint kmer ranges).
- **Across layers**: same kmer space, different counts → partial results **aggregated** (add, OR, etc.).
### MatrixGroupOps
Five required primitives + two default methods derived from them. All return temp-file-backed types.
```rust
pub trait MatrixGroupOps {
// required
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempCompactIntVec>;
fn partial_group_sum(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_any(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>;
fn partial_group_min(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_max(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
// defaults derived from partial_group_presence_count
fn partial_group_all(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == g.indices.len()
fn partial_group_none(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == 0
}
```
Implemented for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
For **bit matrices**: values are 0/1, so `partial_group_sum` = `partial_group_presence_count(g, 1)`; `partial_group_min` is AND (set first column then mask-with remaining); `partial_group_max` is OR via `partial_group_any` + `inc_present`.
**`partial_group_presence_count` — chunking for large groups:**
When `g.indices.len() < 255`: per-slot counts stay within `u8` range. Use `inc_present_fast` (bit) or `inc_predicate_fast(col_view(c), |v| v >= threshold)` (int) — raw u8 increment, no overflow entry written.
When `g.indices.len() ≥ 255`: process in chunks of 254 columns, accumulate via `.add(chunk_frozen.view())`.
**`partial_group_min` (int matrix)**: copy first column via `.add(col_view(first))` (start from 0 ⇒ copy), then `.min(col_view(c))` for remaining.
**`partial_group_max` (int matrix)**: `.max(col_view(c))` for all columns (start from 0 ⇒ first column acts as copy).
**`partial_group_any`** uses `or_where` on `TempBitVecBuilder` (two-pass: primary bytes then overflow entries).
**`partial_group_all` / `partial_group_none`** (default): call `partial_group_presence_count`, then iterate slots to produce the bit result. O(n) extra pass, not chunked.
### add_col_from — matrix builder integration
Both matrix builders accept temp-file results directly:
```rust
// PersistentBitMatrixBuilder
fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()>
fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> // nonzero → 1
// PersistentCompactIntMatrixBuilder
fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()>
fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> // bit → 0/1 u32
```
`add_col_from` copies the temp file to the matrix directory and increments `n_cols`; `close()` writes `meta.json` with the final column count. No separate `write_meta` step needed.
### mask_with
Direct method on `PersistentCompactIntVecBuilder` (and delegation via `TempCompactIntVecBuilder`). Zeros every slot where the corresponding mask bit is 0. Iterates only zero bits — O(n_zeros), O(1) when mask is all-ones.
```
for (w_idx, word) in mask.words():
if word == u64::MAX: continue // skip all-ones words
zeros = !word
while zeros != 0:
bit = trailing_zeros(zeros)
s = w_idx * 64 + bit
if primary[s] != 0: set(s, 0) // clears overflow entry too
zeros &= zeros − 1
```
Terminal operation for Filter (retain only selected kmer slots in a count vector) and Select (positional selection without MPHF).
+143
View File
@@ -0,0 +1,143 @@
# `obitaxonomy` — taxonomy concept paths
`obitaxonomy` is a dependency-free crate that defines a typed representation
of hierarchical concept paths (taxonomic or otherwise) stored in genome metadata.
---
## Concept path syntax
A concept path is stored as a metadata value with the prefix `taxonomy:/`:
```
taxonomy:/enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species
```
Structure:
- The `taxonomy:/` prefix is the type discriminator. Any metadata value starting
with it is parsed as a `TaxPath`; all others remain plain strings.
- The remainder is one or more `/`-separated segments.
- Each segment is `name` or `name@rank`, where `rank` is a label for the
taxonomic level (e.g. `family`, `genus`, `species`).
- Rank annotations are **optional per segment** and can be mixed freely.
- Spaces are allowed in both names and ranks.
### Reserved character
`@` is reserved throughout the taxonomy system and may **not** appear in:
| Context | Constraint |
|---------|------------|
| Segment name | forbidden |
| Rank/class label | forbidden |
| Metadata key names | forbidden (used as `key@rank` in predicate syntax) |
`@` is freely allowed in plain-text metadata values (non-taxonomy).
### Parse errors
| Condition | Error |
|-----------|-------|
| Value does not start with `taxonomy:/` | `MissingPrefix` |
| No segments after the prefix | `EmptyPath` |
| Segment with empty name (consecutive `/`) | `EmptySegmentName` |
| Segment with trailing `@` and no rank (`name@`) | `EmptyRankName` |
| Segment with more than one `@` | `AmbiguousRank` |
---
## Public API
### `TaxSegment`
A single node: a name and an optional rank.
```rust
seg.name() // &str
seg.rank() // Option<&str>
seg.to_string() // "name" or "name@rank"
TaxSegment::parse(s) // Result<TaxSegment, TaxError>
```
### `TaxPath`
```rust
TaxPath::parse(s) // Result<TaxPath, TaxError>
path.segments() // &[TaxSegment]
path.depth() // usize — number of segments
path.is_ancestor_of(&other) // bool — prefix match by name, ranks ignored
path.name_at_rank("genus") // Option<&str>
path.to_string() // reconstructs "taxonomy:/…"
```
`is_ancestor_of` compares segment **names** only — rank annotations are
informational and do not affect the ancestry relation.
```rust
let a: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus".parse()?;
let b: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species".parse()?;
assert!(a.is_ancestor_of(&b)); // true
assert!(b.is_ancestor_of(&a)); // false
assert!(a.is_ancestor_of(&a)); // true (equal ⇒ ancestor)
assert_eq!(b.name_at_rank("species"), Some("Escherichia coli"));
assert_eq!(b.name_at_rank("genus"), Some("Escherichia"));
assert_eq!(b.name_at_rank("order"), None);
```
---
## Integration with `GenomeInfo`
At index load time, every metadata value is inspected once:
- Starts with `taxonomy:/` → parsed into `TaxPath`, stored in `genome.taxonomy`.
- Otherwise → kept as-is in `genome.meta`.
```rust
struct GenomeInfo {
label: String,
meta: HashMap<String, String>, // plain text metadata
taxonomy: HashMap<String, TaxPath>, // parsed taxonomy metadata
}
```
The raw string is not duplicated. `TaxPath::to_string()` reconstructs the
original value losslessly for serialisation.
---
## Predicate operators (in `filter` / `select`)
Path predicates use the `~` / `!~` operators. The **stored value** always starts
with `/` (rooted path); the **query pattern** does not need to.
### Path pattern syntax
| Pattern | Semantics |
|---------|-----------|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B (start-anchored) |
| `A/B$` | value ends with A then B (end-anchored) |
| `/A/B$` | value is exactly A then B (fully anchored) |
| `A@x/B` | A with class `x` followed by B with any class |
| `A@x/B@y` | A with class `x` followed by B with class `y` |
A segment pattern without `@` matches the segment name regardless of its stored class.
### Rank-aware queries
```
key@rank=value
```
| Predicate form | Semantics |
|----------------|-----------|
| `key@rank=value` | genome's `key` has `value` at rank `rank` |
| `key@rank!=value` | does not |
| `key@rank=v1\|v2` | value at `rank` is `v1` or `v2` |
`~` combined with `@rank` on the key (e.g. `key@genus~pattern`) is not defined
and is rejected at parse time.
+5 -1
View File
@@ -19,7 +19,11 @@ The histogram gives:
## Phase 1 — Scatter
Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored. For each read:
Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored.
Input files are read via `open_nuc_stream`, which opens and decompresses the file, auto-detects the format (FASTA / FASTQ / GenBank), and yields a sequence of `NucPage` buffers. Each `NucPage` is a flat 64 KB buffer of normalised bytes (`ACGT` + `\x00` separators), carrying a k−1 byte overlap from the preceding page so that no k-mer is lost at page boundaries. Per-record identity (sequence id, raw bytes) is not preserved; this is intentional — the scatter phase only needs normalised bases to produce superkmers.
For each read fragment within a page:
1. **Ambiguous base filter**: cut at any non-ACGT base; discard fragments shorter than k.
2. **Entropy filter**: scan each fragment with a sliding window of size k. When the kmer $K_i = S[i \mathinner{..} i+k-1]$ ended by nucleotide $S[j]$ (with $j = i+k-1$) has entropy below threshold $\theta$, emit the current segment and start a new one (see algorithm below). $K_i$ belongs to neither segment, and no valid kmer is lost.
+234
View File
@@ -0,0 +1,234 @@
# `select` — column projection and aggregation
`select` transforms an index by operating on its **genome columns**: projecting a
subset of columns, aggregating groups of genomes into synthetic columns, or both.
It is the column-axis counterpart of `filter` (row-axis operations).
Following relational algebra conventions:
| Command | Relational operation | Axis |
|----------|---------------------|----------|
| `filter` | σ — selection | rows (k-mers) |
| `select` | π — projection | columns (genomes) |
The two commands compose naturally: run `filter` first to restrict the kmer set,
then `select` to reshape the genome columns.
`select` never changes the kmer set. The MPHF and `unitigs.bin` of each layer
are preserved unchanged; only the data matrices are rewritten.
---
## Synopsis
```sh
obikmer select <input-index>
{ --output <dir> | --in-place }
[--group <name>:<pred> ...]
[--group-op <name>:<op> ...]
[--aggregate-by <key> ]
[--aggregate-op <op> ]
[--select <col1,col2,...> ]
[--presence-threshold <N> ]
```
---
## Output destination
Exactly one of `--output` or `--in-place` must be specified.
**`--output <dir>`** — writes a new index to `<dir>`. The source index is
unchanged. The MPHF and unitig files are copied; only the data matrices are
rewritten with the new column layout.
**`--in-place`** — rewrites the data matrices of the source index directly.
Removed or replaced columns are lost. The operation writes to temporary files
first, then renames atomically, so an interrupted run leaves the index intact.
---
## Defining output columns
### Named groups — `--group`
```
--group <name>:<pred>
```
Defines a named group of genomes using the same predicate syntax as `filter`.
Repeatable; a genome can belong to several groups.
```sh
--group "pub:species=Betula_pubescens"
--group "nan:species=Betula_nana"
```
### Per-group operator — `--group-op`
```
--group-op <name>:<op>
```
Assigns an aggregation operator to a named group. Optional; if absent, the
default operator applies (see below).
```sh
--group-op "pub:any"
--group-op "nan:all"
```
### Shorthand — `--aggregate-by` / `--aggregate-op`
`--aggregate-by <key>` automatically creates one group per unique value of the
metadata key `<key>`. Equivalent to one `--group <val>:<key>=<val>` per distinct
value. `--aggregate-op <op>` sets the operator for all auto-generated groups.
`--aggregate-by` and `--group` are mutually exclusive.
### Column selection and ordering — `--select`
```
--select col1,col2,...
```
Lists the output columns in order. Each element is either a group name (defined
by `--group` or generated by `--aggregate-by`) or a genome label from the source
index (pass-through, no aggregation).
**Default when `--select` is absent:**
all defined groups in declaration order (for `--group`), or all generated groups
in metadata-value order (for `--aggregate-by`). Individual genomes not in any
group are excluded unless named explicitly.
**When neither `--group` nor `--aggregate-by` is specified:**
`--select` can still reference genome labels for pure column projection (no
aggregation). If `--select` is also absent, all genomes are output unchanged
(identity transform — useful combined with row filtering via a prior `filter`
run).
---
## Aggregation operators
| Operator | Input | Output | Semantics |
|----------|-------------|----------|-----------|
| `any` | pres / count | presence | 1 if ≥ 1 genome in group carries the k-mer |
| `all` | pres / count | presence | 1 if every genome in group carries the k-mer |
| `none` | pres / count | presence | 1 if no genome in group carries the k-mer |
| `sum` | count | count | sum of counts across the group |
| `min` | count | count | minimum count |
| `max` | count | count | maximum count |
**Default operator:**
- Presence index: `any`
- Count index: `sum`
Logical operators (`any`/`all`/`none`) on a count index use
`--presence-threshold N` (default 0): a genome "carries" the k-mer if its count
is > N.
**Output index type:**
- If the source is a presence index, the output is always a presence index.
- If the source is a count index and every output column uses a logical operator
or is a pass-through from a presence source, the output is a presence index.
- Otherwise (at least one arithmetic operator on a count source), the output is
a count index.
---
## Behaviour for edge cases
| Situation | Behaviour |
|-----------|-----------|
| Genome missing the metadata key in `--aggregate-by` | genome ignored (no `NA` group) |
| Genome in multiple groups | contributes independently to each |
| `--group-op` references undefined group | error |
| `--select` element is neither group name nor genome label | error |
| `--output` and `--in-place` both specified | error |
| Neither `--output` nor `--in-place` | error |
| Group with zero matching genomes | column is all-zeros (or all-ones for `none`) |
---
## Examples
### Aggregate by metadata group, default operators
```sh
obikmer select myindex --output out --aggregate-by group
# one column per unique value of "group"; presence→any, count→sum
```
### Named groups with different operators
```sh
obikmer select myindex --output out \
--group "pub:species=Betula_pubescens" \
--group "nan:species=Betula_nana" \
--group-op "pub:any" \
--group-op "nan:all" \
--select "pub,nan"
```
### Mix aggregated group and individual genome
```sh
obikmer select myindex --output out \
--group "A:group=A" \
--select "A,Betula_nana--IGA-24-39"
```
### Pure column projection (no aggregation)
```sh
obikmer select myindex --output out \
--select "Betula_nana--TROM-V-149986,Betula_nana--AG-P04-25-01"
```
### In-place: keep only group A
```sh
obikmer select myindex --in-place --group "A:group=A" --select "A"
```
### Compose with filter
```sh
# Step 1: keep only B. nana-specific k-mers
obikmer filter myindex --output filtered \
--ingroup "species=Betula_nana" --outgroup "*"
# Step 2: aggregate genome columns by collection site
obikmer select filtered --output final --aggregate-by site
```
---
## Implementation notes
`select` does not rebuild the MPHF. The 256 partitions are processed in parallel
(rayon), each writing its output independently; results require no synchronisation
because every partition owns a distinct set of files.
For each layer in each partition:
1. The slot count `n` is read by opening the source data matrix.
2. A new data matrix is built with M columns (M = number of output columns).
3. For each slot `s` in `0..n`:
- `old_row = matrix.fill_row(s)` — reads the original `N`-column row without allocating.
- For each output column `j`:
- `new_row[j] = aggregate(op, old_row[group_indices])`.
- Pass-through columns are represented as single-element groups with the
default operator (`any` for presence, `sum` for count) — same code path.
- The new row is written slot by slot into each column builder.
4. All plain files in the source layer directory (`mphf.bin`, `unitigs.bin`,
evidence files, `layer_meta.json`) are copied verbatim; only the `presence/`
or `counts/` subdirectory is rewritten.
5. `index.meta` is rewritten with the new genome list and updated `with_counts`.
**`--in-place` write strategy:** new data is written to a temporary sibling
directory (`presence_new/` or `counts_new/`); on success the old directory is
removed and the temporary one is renamed into place. An interrupted run leaves
at most one stale `*_new/` directory; the original data is intact until the
rename step.
+21 -6
View File
@@ -9,15 +9,17 @@
| `superkmer` | Extract super-kmers from a sequence file and write to stdout |
| `index` | Build a complete genome index (scatter → dereplicate → count → layered MPHF) |
| `merge` | Merge multiple built indexes into one |
| `rebuild` | Filter and compact an existing index into a new single-layer index |
| `filter` | Apply row-level selection (σ) to an index: retain only k-mers matching the ingroup/outgroup predicates. Output is a new single-layer index — compaction is a consequence, not the goal. Supports the shared [kmer filtering](implementation/filtering.md) system |
| `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed kmers as CSV (kmer + per-genome counts or presence) |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees |
| `unitig` | Dump unitigs from a built index to stdout (debug) |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
| `reindex` | Convert an index's evidence in-place: exact ↔ approx |
| `utils` | Miscellaneous index utilities: `--new-label NEW=OLD` renames a genome label in-place (NEW gets OLD's identity) |
| `utils` | Miscellaneous index utilities: `--new-label NEW=OLD` renames a genome label; `--upgrade-index` adds missing `layer_meta.json` to old indexes |
| `pack` | Pack per-column matrix files into single-file format to reduce query I/O |
## Constraints
@@ -25,7 +27,20 @@
- Maximum efficiency in computation, memory, and disk usage
- k odd, k ∈ [11, 31], fixed at runtime; kmer fits in a u64 (2 bits/base)
- Canonical form: `min(kmer, revcomp(kmer))` reduces strand-symmetric space by half
- Input formats: FASTA, FASTQ, gzip, streaming stdin; `index` reads from stdin automatically when no input files are provided (`-` can also be passed explicitly among other paths)
- Input formats for `index`/`superkmer`: FASTA (`.fa`, `.fasta`), FASTQ (`.fq`, `.fastq`), GenBank flat file (`.gb`, `.gbk`, `.gbff`), all optionally gzip-compressed; directories expanded recursively; streaming stdin via `-`
- Input formats for `query`: FASTA, FASTQ, optionally gzip-compressed; streaming stdin via `-`
## Parameter constraints (enforced at CLI)
All constraints below are checked by `CommonArgs::validate()` at the start of `superkmer` and `index`. Invalid values exit immediately with an error.
| Parameter | Constraint | Reason |
|-----------|-----------|--------|
| k (`--kmer-size`) | odd | even k allows palindromic k-mers: kmer == revcomp(kmer), breaking the canonical form invariant |
| k (`--kmer-size`) | k ∈ [11, 31] | k > 31 overflows u64 at 2 bits/base; k < 11 gives insufficient specificity |
| m (`--minimizer-size`) | odd | same palindrome argument as k |
| m (`--minimizer-size`) | 3 ≤ m ≤ k−1 | minimizer must be strictly shorter than the kmer |
| z (`-z`, Findere, `index --approx` only) | z ≤ k−1 | effective indexed kmer size is k−z+1; z ≥ k would make it ≤ 0 |
## Genome label constraints
+84
View File
@@ -0,0 +1,84 @@
# Installation
## Prerequisites
### Rust toolchain
`obikmer` requires **Rust 1.85 or later** (edition 2024). Install or update via [rustup](https://rustup.rs):
```bash
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh
rustup update stable
```
### C build environment (required for hwloc)
`obikmer` embeds [hwloc](https://www.open-mpi.org/projects/hwloc/) (Hardware Locality) for NUMA-aware thread placement on multi-socket machines. hwloc is built from source at compile time via the `vendored` feature of the `hwlocality` crate. This requires a standard C build environment.
#### Linux (Debian/Ubuntu)
```bash
apt install build-essential automake libtool autoconf pkg-config
```
#### Linux (RHEL/Rocky/AlmaLinux)
```bash
dnf install gcc make automake libtool autoconf pkgconfig
```
#### HPC clusters
Most HPC clusters provide these tools via the module system:
```bash
module load gcc automake libtool autoconf
```
If in doubt, check whether `autoreconf --version` and `libtool --version` return successfully.
#### macOS
```bash
brew install automake libtool autoconf pkg-config
```
## Building
```bash
git clone <repository-url>
cd obikmer/src
cargo build --release
```
The compiled binary is at `target/release/obikmer`.
### Building on HPC clusters (network filesystems)
HPC home directories are typically on a network filesystem (Lustre, NFS) optimised for large sequential reads — not for the thousands of small file operations that Cargo generates during compilation. Building directly on such a filesystem can be extremely slow (0.1% CPU utilisation, tens of minutes for what should take seconds).
**Always redirect the build directory to a local scratch disk:**
```bash
CARGO_TARGET_DIR=/scratch/$USER/cargo-target cargo build --release
```
Adapt the path to the local scratch available on your cluster (`/var/tmp`, `/tmp`, `/scratch/local`, etc.). Once built, copy the binary to a permanent location:
```bash
cp /scratch/$USER/cargo-target/release/obikmer ~/bin/
```
## NUMA support
NUMA-aware thread placement is active automatically on multi-socket Linux machines (detected at runtime via hwloc). No special build flag is required — the detection is built in and falls back gracefully to the single-pool adaptive strategy on:
- macOS (Apple Silicon, unified memory)
- single-socket Linux machines
- any system where hwloc reports only one NUMA node
## Verifying the installation
```bash
obikmer --help
```

Some files were not shown because too many files have changed in this diff Show More