Compare commits

..
153 Commits
Author SHA1 Message Date
Eric Coissac c95c47155e fix: resolve test race conditions, add logging, and fix CI deadlock
Release / create-release (push) Successful in 2m26s
ci.yml / build (pull_request) Successful in 4m4s
Release / build-linux-x86_64 (push) Successful in 8m19s
Release / build-macos-arm64 (push) Successful in 1m48s
Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.
2026-08-11 23:04:06 +02:00
coissac 4f6d442688 Merge pull request 'ci: disable numa feature, bump obikmer, and document Sankoff costs' (#65) from push-oruynkvporsn into main
Reviewed-on: #65
2026-08-11 16:28:07 +00:00
Eric Coissac e6f0ca472c ci: disable numa feature, bump obikmer, and document Sankoff costs
Release / create-release (push) Successful in 2m28s
ci.yml / build (pull_request) Failing after 3h0m41s
Release / build-linux-x86_64 (push) Successful in 8m31s
Release / build-macos-arm64 (push) Successful in 1m53s
Disable the `numa` default feature in CI build and test steps to prevent container environment deadlocks, and add comments explaining the cache key salt bump (`v2`) to mitigate incremental compilation corruption. Document a 16-state Sankoff cost matrix derived from set-edit distances, including substitution, gain/loss, and context-disappearance costs compatible with TNT's interface. Bump `obikmer` crate version to 1.1.43.
2026-08-11 18:26:54 +02:00
coissac 442f7a9e4c Merge pull request 'chore: update ci cache, document distance metrics, and bump version' (#64) from push-wpxsvyylwmsq into main
Reviewed-on: #64
2026-08-11 15:17:42 +00:00
Eric Coissac a63692b8c4 chore: update ci cache, document distance metrics, and bump version
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m43s
Release / build-macos-arm64 (push) Successful in 2m7s
ci.yml / build (pull_request) Canceled after 59m15s
Updated CI workflow cache keys with a `v2` salt and `Cargo.lock` hash to prevent stale incremental compilation caches and deadlocks, while updating restore keys and documenting interrupted job state. Introduced a 3-way ordinal distance metric framework that replaces ambiguous IUPAC encoding with explicit k-mer scoring, bridging pairwise methods to character-based phylogenetics via Sankoff parsimony. Bumped the `obikmer` crate version to 1.1.42.
2026-08-11 17:12:28 +02:00
coissac fa82989ea9 Merge pull request 'refactor: centralize CPU core detection using cgroup-aware utility' (#63) from push-lqzukpulzykz into main
Reviewed-on: #63
2026-08-11 10:35:06 +00:00
Eric Coissac 5f95e866f8 refactor: centralize CPU core detection using cgroup-aware utility
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Successful in 1m43s
ci.yml / build (pull_request) Canceled after 1h29m17s
Introduce `obisys::effective_parallelism()` to read Linux cgroup v1/v2 CPU quotas from sysfs, preventing thread pool oversubscription in containerized environments. Replace direct `std::thread::available_parallelism()` calls across `obikindex` and `obikmer` with this centralized function. Bump `obikmer` version to 1.1.41.
2026-08-11 12:23:05 +02:00
coissac 2e7cfc4368 Merge pull request 'Push lsqnpxrxuvpp' (#62) from push-lsqnpxrxuvpp into main
Reviewed-on: #62
2026-08-11 09:09:23 +00:00
Eric Coissac f5e508ed33 feat: add multi-genome SNP pseudo-alignment and CLI export
Release / create-release (push) Successful in 5m58s
Release / build-macos-arm64 (push) Successful in 2m47s
Release / build-linux-x86_64 (push) Successful in 8m50s
CI / build (pull_request) Canceled after 5m42s
Introduces a `SnpAlignment` struct and helper methods to construct per-genome SNP pseudo-alignments from sibling k-mer data, filtering monomorphic families and encoding bases as IUPAC ambiguity codes. Exposes the type at the crate root for simplified imports. Adds a `--snp` CLI flag to compute and export these alignments as an IUPAC-coded FASTA file. Updates theory documentation to propose a multi-genome framing approach for joint phylogenetic inference, resolving pairwise correspondence ambiguities through positional homology and partial coverage thresholds. Bumps crate version to 1.1.40.
2026-08-10 22:38:38 +02:00
Eric Coissac 49f329edd5 feat: add raw SNP distance calculation and CLI flag
Exposes RawSnpDistanceOutput and implements KmerIndex::raw_snp_distance() to compute pairwise single-copy locus counts under a paralogy-aware rule. The implementation leverages ndarray for parallel matrix aggregation, producing raw p-distance matrices for sanity-checking. A --raw-snp-distance CLI flag is added to export results as CSV, mapping zero-eligible pairs to NA.
2026-08-10 22:17:07 +02:00
Eric Coissac 1a470eab9e Refactor k-mer sibling tracking to compact bitmask and on-demand counts
Replaces the explicit `SiblingInfo` struct and 3-bit minorant flags with a derived 4-bit presence mask (`FamilyMask`) that tracks observed bases per family. This eliminates redundant file I/O overhead by introducing a `PartitionCache` for batch lookups, simplifies serialization, and updates all downstream builders, stats computation, and tests to operate on the new bitmask representation. Adjusts CLI output to report deduplicated family sizes instead of histograms, ignores generated CSV files, and updates documentation to reflect the fixed canonical reference and new theory.
2026-08-10 17:53:52 +02:00
Eric Coissac ba990a48a0 feat: add obipipeline for concurrent sibling annex stats
Add the `obipipeline` crate and replace sequential scatter/gather logic with a concurrent pipeline using `Flat` and `Transform` stages. Introduce `SiblingAnnexStats` API to compute distributions, and add CLI flags to `distance.rs` for constructing the annex and exporting statistics as CSV.
2026-08-10 15:31:04 +02:00
Eric Coissac ea914bb536 feat: implement per-k-mer sibling counts and central neighbor generation
Introduce the siblingannex module in obicompactvec to store per-slot minorant flags and sibling counts in a memory-mapped annex file. Add a scatter-gather pipeline in obikindex to compute these values across index layers and write them to .psib files. Implement central_canonical_neighbors in obikseq for generating strand-aware k-mer variants around the middle base. Expose rolling statistics in obiskbuilder and update dependency graphs accordingly.
2026-08-10 15:01:59 +02:00
Eric Coissac 8bc6d533e5 feat: support negative count filters as group size offsets
Updates CLI parsing to accept negative integers for count filters, interpreting them as offsets from the group size (e.g., `-1` means all but one). A resolution closure enforces a floor of 1 to prevent unconstrained filtering on small groups. Additionally, refines evolutionary distance documentation to condition comparisons on local homology, replacing union-based Jaccard with a self-contained `SnpTally`. This unified approach streamlines SNP and shared count computation, incorporates paralogy and heterozygosity handling, and enables direct derivation of corrected distance matrices without external dependencies.
2026-08-10 12:38:35 +02:00
Eric Coissac 45df9919e5 docs: add central-position SNP distance estimator spec
Introduces a design specification for inferring substitution rates directly from k-mers with conserved flanks. The document details a memory-efficient implementation that computes 4x4 base-pair tallies using existing MPHF structures, enabling classical corrections without de Bruijn graph materialization. Updates MkDocs navigation to include the new theory page.
2026-07-10 09:49:49 +02:00
Eric Coissac 2610a4af79 feat: add Mash distance metric and rolling entropy support
Implement the Mash distance metric across the CLI, index, and compact vector traits. This includes adding a `Mash` variant to the `DistanceMetric` enum and `MetricArg` CLI argument, implementing the conversion from Jaccard distances using the standard mutation-rate estimator formula, and updating documentation with supported metrics and algorithmic references. Additionally, add an `entropy` method to rolling statistics for computing order-specific entropy.
2026-07-09 11:40:48 +02:00
coissac dc3392865f Merge pull request 'Push qowsvpqmoukq' (#61) from push-qowsvpqmoukq into main
Reviewed-on: #61
2026-07-08 18:05:42 +00:00
Eric Coissac fd2c23e7df refactor: remove equivalence class folding from entropy pipeline
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m17s
Release / build-macos-arm64 (push) Successful in 1m41s
CI / build (pull_request) Successful in 3m33s
Removes circular-reverse complement machinery and explicit k-mer canonicalization across the entropy pipeline. Frequency tallying and Shannon entropy computation now operate directly on raw k-mer values, eliminating prior score inflation and alignment-dependent artifacts while preserving orientation invariance. Updates build scripts to generate normalized lookup tables for k-mer lengths 1–6, restricts the public API to `EntropyTracker`, and bumps crate versions. Documentation is updated to reflect the simplified raw-value approach and revised module structure.
2026-07-08 19:36:30 +02:00
Eric Coissac 912f788f7f feat: extract k-mer entropy computation into new obikentropy crate
Extracts streaming entropy logic and sliding-window frequency tracking from obiskbuilder into a dedicated obikentropy crate. Introduces an EntropyTracker accumulator for O(1) per-base normalized Shannon entropy, replaces inline rolling statistics with delegated state management, and updates workspace dependencies across obikindex, obikpartitionner, and obiskbuilder. Adds criterion benchmarks to validate the refactored pipeline throughput.
2026-07-08 18:36:16 +02:00
Eric Coissac e725523898 feat: add entropy-driven k-mer complexity filtering
Introduces a MinComplexity filter driven by new CLI arguments, enabling sequence-aware threshold checks during index reconstruction and partitioning. Adds the kmer_entropy module for normalized complexity scoring, updates the KmerFilter trait to evaluate per-kmer context, and refactors test modules for better organization.
2026-07-08 12:48:25 +02:00
coissac 165982fb07 Merge pull request 'Bump obikmer version to 1.1.38 and add memory footprint logging' (#60) from push-slxmykzqmzzv into main
Reviewed-on: #60
2026-07-08 10:15:51 +00:00
Eric Coissac 2740f52326 Bump obikmer version to 1.1.38 and add memory footprint logging
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m8s
Release / build-macos-arm64 (push) Successful in 1m43s
Updates Cargo.toml version from 1.1.37 to 1.1.38. Adds explicit memory footprint estimation for the `by_partition` k-mer dedup HashMap by computing capacity-based byte sizes for map slots and stored descriptors. These metrics are logged via `debug!` to track actual memory pressure during chunk processing.
2026-07-08 12:14:58 +02:00
coissac dff5d2f457 Merge pull request 'Push smluomvxpptv' (#59) from push-smluomvxpptv into main
Reviewed-on: #59
2026-07-07 17:13:03 +00:00
Eric Coissac eea884f393 ci: improve release workflow and bump obikmer to v1.1.37
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m5s
Release / build-macos-arm64 (push) Successful in 1m41s
Replace inline `docker run` with explicit container lifecycle management to improve isolation and verify exit statuses. Bump `obikmer` crate version to 1.1.37. Add debug logging for sparse hit structure memory tracking, update chunk memory documentation to reflect the Findere rework, and clarify `BYTES_PER_KMER_PER_GENOME` as a pathological bound for safety tuning.
2026-07-07 19:11:50 +02:00
Eric Coissac ae42a061bd perf: optimize k-mer queries with sparse index and run-based aggregation
Replaces the dense `KmerResults` matrix with a sparse `SmerIndex` (`Vec<bool>` + offsets) that tracks k-mer presence independently of per-genome counts. Introduces a new aggregation pass, `sparse_findere_for_genome`, which sorts hits, detects contiguous runs, and applies monotone-deque scans to compute sliding-window minimums. This reduces query complexity from O(n_smers) to O(hits log hits), significantly lowering memory overhead and computational cost for low-density queries. Adds a deterministic PRNG and dense reference oracle in tests to validate correctness against randomized inputs without external property-testing crates.
2026-07-07 18:56:41 +02:00
Eric Coissac 040eff140c refactor(query): optimize mmap locality with column-major matrix fetch
Refactor the query pipeline into a two-stage MPHF hit-detection pass followed by a column-major matrix fetch to improve cache efficiency. Introduce a QueryHit enum for event-driven callbacks, decoupling hit detection from data population. Add scan/fetch metrics to QueryStats, update Phase 4 architecture docs, and align tests with the new callback signature.
2026-07-07 18:44:09 +02:00
Eric Coissac a348637f3b refactor(query): deduplicate k-mers upfront and split MPHF lookup
Refactor `QueryBatch` construction to perform canonical k-mer deduplication and partition routing during initialization, eliminating post-batch splitting. Split the `QueryLayer` MPHF lookup into separate `find_slot` and `fill_row` methods, updating callbacks to pass occurrence descriptors instead of indices. Introduce `QueryStats` for tracking MPHF calls and dereplication ratios, and add comprehensive unit tests for batch construction, stats arithmetic, and safe partition handling. Expose new query-layer types in the public API.
2026-07-07 18:36:25 +02:00
Eric Coissac 9d7ced4493 perf(query): replace static divisor with dynamic overhead multiplier
Replaces the static 16 divisor with a dynamic overhead_multiplier that scales chunk size based on n_genomes, the --detail flag, and a safety factor. This bounds per-chunk memory usage to ≤50% of available RAM across concurrent workers by accounting for genome-scaled k-mer buffers and optional coverage data.
2026-07-07 16:14:10 +02:00
Eric Coissac 9d49929b0c refactor(query): implement throttled per-file streaming pipeline
Replace the flat chunk iterator with a throttled, per-file streaming architecture using `obipipeline::throttle`. The new `GuardedChunkIter` binds file handles to their `ThrottleGuard`, enforcing concurrent open-file limits and tracking active files via an atomic counter. Pipeline stages and the progress spinner are updated to support this resource-aware, parallelized I/O flow.
2026-07-07 16:07:33 +02:00
Eric Coissac 61c390503d feat(query): add throughput metering and --max-open-files flag
Introduces an EMA-based throughput meter that dynamically updates a spinner with MB/s rates, along with atomic counters for tracking cumulative bytes and active chunks. Adds final pipeline reporting and consolidates imports for cleaner performance instrumentation.
2026-07-07 15:19:09 +02:00
Eric Coissac 8f0ceec784 docs: clarify query processing and add performance roadmap
Clarifies that query processing is fully inlined within `process_chunk` using flat allocations, refining monotone-deque sliding window semantics and `kmer_missing` tracking. Updates `QueryLayer::open` variant precedence and introduces a phased roadmap (Phases 0–6) to address performance bottlenecks through parallel I/O, genome-aware chunk sizing, k-mer dereplication, NUMA-aware matrix fetches, and sparse Findere rework.
2026-07-07 15:12:09 +02:00
Eric Coissac 00b4b1fa51 docs: add future work section for parallel gzip decompression
Proposes replacing the single-threaded niffler/flate2 pipeline in `obiread::xopen` with `rapidgzip-rs` for local `.gz` files. Details constraints such as path dependencies, non-seekable streams, C++ toolchain requirements, and binding maturity. Marks the optimization as parked pending throughput and correctness validation.
2026-07-07 13:43:01 +02:00
coissac e96ad38c8e Merge pull request 'feat: filter zero-valued entries from kmer strict matches output' (#58) from push-rosnxrytzxzk into main
Reviewed-on: #58
2026-07-07 09:22:02 +00:00
Eric Coissac 4fc7860825 feat: filter zero-valued entries from kmer strict matches output
Release / create-release (push) Successful in 2m32s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m23s
Optimize query serialization by conditionally excluding genomes with zero total matches. This reduces JSON payload size while preserving the label-to-count mapping structure. Updates architecture documentation and bumps version to 1.1.36.
2026-07-07 10:50:01 +02:00
coissac 5bdc0f826a Merge pull request 'fix: validate packed matrix columns before repacking' (#57) from push-vkqvorvsqnqx into main
Reviewed-on: #57
2026-07-03 15:26:55 +00:00
Eric Coissac cd2f2f9417 fix: validate packed matrix columns before repacking
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m15s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m17s
Add header parsing helpers to extract column counts without memory mapping. Update packing functions to verify existing files match current metadata, preventing stale or widened-column artifacts. Extract inline tests in obilayeredmap to an external module and add comprehensive aggregation tests. Bump obikmer to 1.1.35 and clean up repository configuration.
2026-07-03 17:20:22 +02:00
coissac 7844239a8e Merge pull request 'Push msotyzponsls' (#56) from push-msotyzponsls into main
Reviewed-on: #56
2026-07-03 11:28:49 +00:00
Eric Coissac 2b37e8aac4 fix(bitmatrix): explicitly compute diagonal entries for self-similarity
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m21s
The pairwise matrix functions now explicitly calculate and overwrite diagonal entries using `f(i,i)`, replacing previous implicit symmetric mirroring or default values. Documentation has been updated to clarify that diagonals represent self-comparison weights, ensuring accurate self-similarity calculations. Additionally, the obikmer crate version has been bumped to 1.1.34.
2026-07-03 13:04:40 +02:00
Eric Coissac 67b4e4da53 refactor(numa): replace flat runner with per-node activation channels
Shifts the NUMA-aware runner from a flat, round-robin model to a per-node architecture using dedicated `NodeActivation` channels. Replaces absolute deltas with relative scaling based on the previous growth step's worker count, decoupling growth from node count to fix slow ramp-up and enforce per-node fairness. Updates architecture documentation to reflect these changes and focus tuning questions on `INITIAL`/`GROWTH_DIVISOR` parameters for I/O-bound validation.
2026-07-03 13:03:31 +02:00
coissac 66ab4c6db1 Merge pull request 'feat(numa): introduce I/O sampling to prevent activation stalls' (#55) from push-ooruxnkktvvz into main
Reviewed-on: #55
2026-07-02 09:36:19 +00:00
Eric Coissac f84dd539bf feat(numa): introduce I/O sampling to prevent activation stalls
Release / create-release (push) Successful in 2m25s
Release / build-linux-x86_64 (push) Successful in 8m47s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m30s
Replaces the monolithic CPU scaling threshold with separate CPU and I/O spawn thresholds. Introduces an `IoSample` struct with platform-specific byte reading and a relative throughput growth heuristic. Adds a 0.1s wall-clock guard to `CpuSample` to suppress artificial efficiency spikes, and updates `maybe_activate` to trigger worker scaling when either resource indicates headroom. Bumps `obikmer` to v1.1.33 and updates architecture documentation.
2026-07-02 10:07:22 +02:00
coissac 6378734e1c Merge pull request 'fix(obisys): remove activation guard to always update metrics' (#54) from push-vkloynurrxzu into main
Reviewed-on: #54
2026-07-01 18:34:10 +00:00
Eric Coissac b3a617cce1 fix(obisys): remove activation guard to always update metrics
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m35s
Release / build-linux-x86_64 (push) Successful in 8m9s
Release / build-macos-arm64 (push) Failing after 30s
Removes the `if activate` conditional in `src/obisys/src/lib.rs`, making debug logging and state updates for performance counters execute unconditionally. This ensures tracking metrics are continuously refreshed regardless of the activation threshold. Also bumps the `obikmer` dependency version.
2026-07-01 20:32:56 +02:00
coissac 2080e5e8a9 Merge pull request 'ci: fix registry auth and bump obikmer to 1.1.30' (#53) from push-zxlknspoxknt into main
Reviewed-on: #53
2026-07-01 14:20:09 +00:00
Eric Coissac 45ed2bc9b8 ci: fix registry auth and bump obikmer to 1.1.30
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m12s
Release / build-macos-arm64 (push) Failing after 1m55s
CI / build (pull_request) Successful in 3m32s
Update the release workflow to explicitly resolve the Docker registry username from repository secrets instead of inferring it from the runner's actor. Bump the obikmer package version to 1.1.30.
2026-07-01 14:31:30 +02:00
coissac aa126fd89d Merge pull request 'feat: simplify worker spawning logic and update macOS build workflow' (#52) from push-uvmlknmzqqnx into main
Reviewed-on: #52
2026-07-01 09:50:51 +00:00
Eric Coissac c612132763 feat: simplify worker spawning logic and update macOS build workflow
Release / create-release (push) Successful in 2m59s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 8s
CI / build (pull_request) Successful in 3m24s
Updates the release workflow to run macOS builds inside a Docker container with explicit registry authentication and adjusted artifact paths. Bumps the obikmer crate version to 1.1.29 and adds *.log to .gitignore. Simplifies NUMA worker spawning by lowering the activation threshold from 0.95 to 0.2, replacing complex stateful tracking with a direct efficiency check, and downgrading progress logging to debug level. Includes general code formatting improvements for readability.
2026-07-01 11:40:57 +02:00
coissac 19660f8cd0 Merge pull request 'ci: update registry auth and improve adaptive worker scaling' (#51) from push-qlpywtroutvx into main
Reviewed-on: #51
2026-06-26 13:16:23 +00:00
Eric Coissac 7b07540a69 ci: update registry auth and improve adaptive worker scaling
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m17s
Release / build-linux-x86_64 (push) Successful in 8m3s
Release / build-macos-arm64 (push) Failing after 1s
Refactor the release workflow to use a structured container object with authenticated pulls for macOS ARM64 builds. Replace single-worker activation with dynamic upfront provisioning based on node and worker counts. Implement an absolute efficiency gain threshold for scaling checks and add early termination to improve adaptive scaling stability. Bump obikmer crate version to 1.1.27.
2026-06-26 15:13:13 +02:00
coissac 89c43e28f5 Merge pull request 'ci: update release workflow and bump obikmer to 1.1.26' (#50) from push-npttlqpomtvz into main
Reviewed-on: #50
2026-06-24 13:55:40 +00:00
Eric Coissac b9b2e42ad2 ci: update release workflow and bump obikmer to 1.1.26
Release / create-release (push) Successful in 2m32s
CI / build (pull_request) Successful in 3m47s
Release / build-linux-x86_64 (push) Successful in 8m18s
Release / build-macos-arm64 (push) Failing after 0s
Replaces the macOS ARM64 cross-compilation container with a custom internal registry image. Adds explicit steps to install the `aarch64-apple-darwin` Rust target and `jq`, and updates the build command to use `--no-default-features`. Bumps the `obikmer` package version from 1.1.25 to 1.1.26.
2026-06-24 15:55:02 +02:00
coissac ca42fdff2f Merge pull request 'ci: update macOS ARM64 build workflow and bump obikmer version' (#49) from push-lllnsqlrqrut into main
Reviewed-on: #49
2026-06-23 13:15:20 +00:00
Eric Coissac 136cd89efb ci: update macOS ARM64 build workflow and bump obikmer version
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 7m52s
Release / build-macos-arm64 (push) Failing after 8m53s
CI / build (pull_request) Successful in 5m31s
Replace manual Zig/cargo-zigbuild setup with a pre-configured Docker container (`joseluisq/rust-linux-darwin-builder`). Use explicit Clang cross-compilers for native macOS ARM64 compilation. Bump the `obikmer` package version to 1.1.25.
2026-06-23 15:01:17 +02:00
coissac a4bbf607b7 Merge pull request 'Push kxsopnzprltv' (#48) from push-kxsopnzprltv into main
Reviewed-on: #48
2026-06-23 09:51:33 +00:00
Eric Coissac 9927100a1c chore: update obikmer to 1.1.24
Release / create-release (push) Successful in 2m24s
Release / build-linux-x86_64 (push) Successful in 7m49s
Release / build-macos-arm64 (push) Failing after 3m31s
CI / build (pull_request) Successful in 3m22s
Bumps the obikmer version in Cargo.toml from 1.1.21 to 1.1.24 and updates Cargo.lock to align with the upstream patch release (1.1.23). This ensures consistent dependency resolution across builds.
2026-06-23 11:47:54 +02:00
Eric Coissac 527258f822 ci: enforce macOS 11.0 deployment target for ARM builds
Adds MACOSX_DEPLOYMENT_TARGET=11.0 environment variable and updates the cargo zigbuild target to aarch64-apple-darwin11.0 to explicitly require macOS 11.0 for ARM binary compilation.
2026-06-23 11:46:09 +02:00
coissac ef62f1947e Merge pull request 'chore: bump version to 1.1.21 and update obikindex features' (#47) from push-xwutoxpnxorz into main
Reviewed-on: #47
2026-06-23 08:31:31 +00:00
Eric Coissac d02316dcf6 chore: bump version to 1.1.21 and update obikindex features
Release / create-release (push) Successful in 2m29s
CI / build (pull_request) Successful in 4m36s
Release / build-linux-x86_64 (push) Successful in 10m25s
Release / build-macos-arm64 (push) Failing after 4m50s
Disables default features for the `obikindex` dependency and introduces a `[features]` block. The new `numa` feature is set as the default, conditionally enabling NUMA support in `obikindex`.
2026-06-23 10:30:39 +02:00
coissac c323b3eaef Merge pull request 'Bump obikmer to 1.1.20 and update release workflow' (#46) from push-wpnywwlwxrps into main
Reviewed-on: #46
2026-06-23 08:03:58 +00:00
Eric Coissac b77d8e9ca0 Bump obikmer to 1.1.20 and update release workflow
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m14s
Release / build-linux-x86_64 (push) Successful in 7m44s
Release / build-macos-arm64 (push) Failing after 7m13s
Update the Gitea release workflow to fetch a full git clone with complete history, ensuring all commits and tags are available for accurate version resolution. This prepares the repository for the standard patch-level release of obikmer v1.1.20.
2026-06-23 10:03:15 +02:00
coissac 7c5bab3694 Merge pull request 'fix(ci): restrict workflow to PRs and improve release tagging' (#45) from push-louqrszyuqpz into main
Reviewed-on: #45
2026-06-23 07:52:35 +00:00
Eric Coissac fab4e0d6de fix(ci): restrict workflow to PRs and improve release tagging
Release / create-release (push) Failing after 26s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m17s
Restrict the CI pipeline to pull request events only by removing the unconfigured push trigger and eliminating a duplicate pull_request block in the workflow file. Update the Makefile to suppress stderr from the aichat command and introduce a fallback release tag message for robust version tagging. Additionally, bump the obikmer crate version to 1.1.19.
2026-06-23 09:42:23 +02:00
coissac 973a3f3d6e Merge pull request 'feat: add numa feature flag and automate release workflow' (#44) from push-uymxyvsyooro into main
CI / build (push) Successful in 3m16s
Reviewed-on: #44
2026-06-23 07:22:33 +00:00
Eric Coissac 1a839a295a feat: add numa feature flag and automate release workflow
Release / create-release (push) Failing after 37s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m23s
Refactor the Gitea release pipeline to generate releases via API and upload binaries using a shared ID. Automate changelog generation by fetching recent commits with `jj log` and producing markdown notes via `aichat`. Convert `hwlocality` to an optional dependency gated by a default `numa` feature, providing fallback implementations for graceful degradation when NUMA support is disabled. Bump obikmer to 1.1.18.
2026-06-23 09:07:04 +02:00
coissac 2ea58703c7 Merge pull request 'Push zkptpswyxnvt' (#43) from push-zkptpswyxnvt into main
CI / build (push) Successful in 3m19s
Reviewed-on: #43
2026-06-22 16:29:59 +00:00
Eric Coissac ac3ef106e7 refactor: implement adaptive worker scaling and infallible NUMA build
Release / build-linux-static (push) Successful in 8m4s
CI / build (pull_request) Successful in 3m26s
Replaces the fallible NUMA topology builder with an infallible fallback that synthesizes a single-node UMA configuration on failure or absence. Refactors PartitionRunner to pre-spawn dormant workers and dynamically activate them via CPU efficiency thresholds, replacing static upfront spawning with adaptive scaling. Bumps obikmer crate version to 1.1.15.
2026-06-22 18:29:39 +02:00
Eric Coissac 469e53b6f5 Add genomic distance benchmarking suite and test data
Introduces scripts to compute and validate pairwise genomic distance matrices across multiple metrics. Updates the Makefile with build and comparison targets, adds .gitignore rules for generated outputs, and includes test CSV matrices and a Newick phylogenetic tree for validating the distance computation pipeline.
2026-06-22 18:24:30 +02:00
Eric Coissac 9f1df96ea7 ci: restrict push trigger to main branch
Replace the wildcard `['**']` in the push trigger with `['main']`. This prevents redundant pipeline runs on non-main branches during push events.
2026-06-22 16:58:44 +02:00
coissac 4e4cce2879 Merge pull request 'fix(ci): enable cross-compilation in release workflow and bump obikmer' (#42) from push-sxlpkrkyuttk into main
CI / build (push) Successful in 3m20s
Reviewed-on: #42
2026-06-22 14:31:26 +00:00
Eric Coissac 68b05b93c4 fix(ci): enable cross-compilation in release workflow and bump obikmer
CI / build (push) Successful in 4m38s
Release / build-linux-static (push) Successful in 10m14s
CI / build (pull_request) Successful in 3m40s
Injects PKG_CONFIG_ALLOW_CROSS=1 into the static binary build step to ensure correct native dependency resolution during musl target compilation with cargo zigbuild. Also updates the obikmer crate version from 1.1.13 to 1.1.14.
2026-06-22 16:31:04 +02:00
coissac 0a668cf8a6 Merge pull request 'chore: bump obikmer to 1.1.13 and fix Makefile revision tag' (#41) from push-qwzpxktnlyls into main
CI / build (push) Has been cancelled
Reviewed-on: #41
2026-06-22 14:18:25 +00:00
Eric Coissac e6d6942e2f chore: bump obikmer to 1.1.13 and fix Makefile revision tag
CI / build (push) Has been cancelled
Release / build-linux-static (push) Has been cancelled
CI / build (pull_request) Has been cancelled
Update the obikmer crate version from 1.1.12 to 1.1.13 in Cargo.toml. Additionally, change the Makefile's Git revision specifier from @- to @ to ensure the version tag is applied to the current commit before pushing.
2026-06-22 16:17:52 +02:00
coissac bf9c9aeacb Merge pull request 'chore: bump version to 1.1.12 and fix release workflow' (#40) from push-zmkxouxypspm into main
CI / build (push) Has been cancelled
Reviewed-on: #40
2026-06-22 14:13:13 +00:00
Eric Coissac 22a65857a1 chore: bump version to 1.1.12 and fix release workflow
CI / build (push) Successful in 3m14s
CI / build (pull_request) Successful in 3m51s
Update Cargo.toml to 1.1.12 for a semver patch release. Refactor the Makefile release target to explicitly retrieve the parent commit hash via `jj log` and apply the tag, replacing implicit working directory tagging. Remove `jj auto-describe` and `--change @` in favor of an explicit `git push origin` for the version tag.
2026-06-22 16:12:56 +02:00
coissac d16a867640 Merge pull request 'ci: bypass PEP 668 restrictions and update obikmer to 1.1.11' (#39) from push-mxysluysloxr into main
CI / build (push) Successful in 4m1s
Release / build-linux-static (push) Failing after 7m28s
Reviewed-on: #39
2026-06-22 13:52:51 +00:00
Eric Coissac 616050075f ci: bypass PEP 668 restrictions and update obikmer to 1.1.11
CI / build (push) Successful in 3m41s
CI / build (pull_request) Successful in 3m49s
Add the `--break-system-packages` flag to the `pip install ziglang` command in the Gitea release workflow to bypass PEP 668 restrictions on modern Linux distributions. Additionally, bump the `obikmer` crate version from 1.1.9 to 1.1.11 across both Cargo.toml and Cargo.lock.
2026-06-22 15:52:34 +02:00
coissac e22afe9621 Merge pull request 'chore: bump obikmer to 1.1.9 and update release workflow' (#38) from push-noxuppsknsol into main
CI / build (push) Successful in 3m11s
Release / build-linux-static (push) Failing after 3m4s
Reviewed-on: #38
2026-06-22 13:32:50 +00:00
Eric Coissac bdfac71e65 chore: bump obikmer to 1.1.9 and update release workflow
CI / build (push) Successful in 3m24s
CI / build (pull_request) Failing after 0s
Bumps the obikmer crate version from 1.1.7 to 1.1.9 in Cargo.toml and Cargo.lock. Updates the Gitea release workflow to dynamically locate the Zig compiler via Python, generating musl-targeted gcc/g++ wrapper scripts installed to /usr/local/bin for static Linux cross-compilation during releases.
2026-06-22 15:32:10 +02:00
coissac a00bb37478 Merge pull request 'ci: switch to Zig build toolchain and bump obikmer to 1.1.7' (#37) from push-nvvqmzmrotxx into main
CI / build (push) Successful in 3m14s
Release / build-linux-static (push) Failing after 2m42s
Reviewed-on: #37
2026-06-22 13:20:12 +00:00
Eric Coissac d30a4efd9b ci: switch to Zig build toolchain and bump obikmer to 1.1.7
CI / build (push) Successful in 3m12s
CI / build (pull_request) Successful in 3m16s
Replaces the musl-based static Linux build toolchain with Zig (`ziglang` via pip and `cargo-zigbuild`), removing `musl-tools` dependencies. The workflow now invokes `cargo zigbuild` for cross-compiling the static binary. Additionally, bumps the `obikmer` crate version to 1.1.7.
2026-06-22 15:19:39 +02:00
coissac 6baf2e64ca Merge pull request 'chore: bump obikmer to 1.1.6 and automate git tagging' (#36) from push-yxmtknzsynpx into main
CI / build (push) Successful in 3m20s
Release / build-linux-static (push) Failing after 4m30s
Reviewed-on: #36
2026-06-22 13:01:06 +00:00
Eric Coissac c0a71a2d49 chore: bump obikmer to 1.1.6 and automate git tagging
CI / build (push) Successful in 4m46s
CI / build (pull_request) Successful in 4m27s
Bumps the obikmer crate version from 0.1.4 to 1.1.6 in Cargo.toml and Cargo.lock. Updates the Makefile release target to automatically extract the version, create a Git tag, and push it to the remote repository, extending the existing workflow with standard Git publishing steps.
2026-06-22 15:00:36 +02:00
coissac a609c1af95 Merge pull request 'ci: streamline release workflow and bump obikmer to 0.1.4' (#35) from push-zokprynyqunu into main
CI / build (push) Successful in 4m41s
Release / build-linux-static (push) Failing after 6m4s
Reviewed-on: #35
2026-06-22 09:38:36 +00:00
Eric Coissac 3d32be8a83 ci: streamline release workflow and bump obikmer to 0.1.4
CI / build (push) Successful in 4m33s
CI / build (pull_request) Successful in 4m17s
Replaces the intermediate artifact upload step in the Gitea release workflow with a direct REST API call, eliminating unnecessary dependencies and adding `jq`. Also increments the obikmer crate version to 0.1.4.
2026-06-22 11:38:19 +02:00
coissac c4c71dc892 Merge pull request 'Push mtzqmmrlmzzx' (#34) from push-mtzqmmrlmzzx into main
CI / build (push) Successful in 4m34s
Reviewed-on: #34
2026-06-22 08:47:24 +00:00
Eric Coissac 4e625afaba refactor: update CI toolchain setup and optimize parallel indexing
CI / build (push) Successful in 4m56s
CI / build (pull_request) Successful in 4m11s
Update CI workflows to explicitly install the Rust toolchain via rustup and configure musl targets for deterministic static builds in Docker containers. Bump obikmer dependency to 0.1.3. Refactor obicompactvec to reduce peak memory usage by computing column sizes from filesystem metadata, add atomic writes, and implement cleanup guards. Replace parallel iteration patterns in obikindex with a structured PartitionRunner pipeline for simplified error handling and progress tracking.
2026-06-22 10:46:24 +02:00
Eric Coissac a522c0907e feat: add CI/CD workflows, release automation, and CLI version flag
CI / build (push) Failing after 2m41s
CI / build (pull_request) Failing after 6s
Adds Gitea Actions for continuous integration and tagged releases, including static musl binary compilation and artifact upload. Introduces a Makefile target to automate semantic version bumping and publishing. Bumps the package version to 0.1.1 and enables automatic `--version` output via Clap.
2026-06-22 10:36:40 +02:00
Eric Coissac c1d6f277ce feat(select): add metrics reporting to selection methods
Integrates an obisys::Reporter across indexing and command modules to capture execution metrics. Replaces discarded timer stops with explicit rep.push() calls, adds timing instrumentation for the pack stage, and prints collected reports after each selection branch.
2026-06-22 10:25:24 +02:00
Eric Coissac 9356be4ec0 feat: introduce obitaxonomy crate for hierarchical taxonomy parsing
Adds the `obitaxonomy` crate to parse and validate hierarchical taxonomy paths using a strict `taxonomy:/name@rank/...` syntax. Replaces generic string-based path matching in predicates with structured `TaxPath` and `TaxPattern` types, enforcing explicit anchor constraints and rank-aware semantics. Updates filtering documentation to clarify optional leading slashes and segment-boundary matching rules.
2026-06-22 10:24:04 +02:00
Eric Coissac c694e1f2b0 feat: add benchmark pipeline, expose APIs, and enforce strict paths
Introduces a Make-based orchestration for simulating, indexing, merging, filtering, and verifying k-mer counts and presence. Exposes internal builder and iterator APIs publicly, enforces mandatory leading slashes for predicate patterns, registers the `obitaxonomy` crate, and updates tooling configurations alongside documentation.
2026-06-22 10:18:33 +02:00
Eric Coissac 280ca1f5a3 feat: add optimized new_ones constructor for all-ones bit vectors
Introduces `new_ones` and `add_col_ones` methods to directly initialize all-ones bit vectors and matrix columns. This replaces redundant initialization sequences that created zero-filled structures and applied bitwise NOT, with a single pass that writes contiguous 0xFF bytes to disk. The change eliminates inversion overhead, streamlines test setup, and improves performance for filter mask intersection logic while preserving identical semantics.
2026-06-22 10:00:01 +02:00
Eric Coissac 9abb2db92f refactor: replace explicit bit-setting loops with optimized bulk operations
Refactor bitmatrix, colgroup, and layer modules to replace manual iteration with concise `or_where` predicates and bulk inversion calls. This simplifies the codebase and leverages optimized internal implementations for improved performance.
2026-06-22 09:56:41 +02:00
Eric Coissac 7c1efa9cbb feat: add vectorized column filters and optimize partitioner iteration
Adds `FilterMask` and conditional bitwise methods (`*_where`) to `obicompactvec` for composable column-based slot filtering. Extends `obikpartitionner` with a `MatrixGroupOps` trait and `column_mask_expr` method to express aggregate constraints as vectorized masks. Refactors matrix builder management into a unified `Builders` enum and introduces `try_compute_combined_mask`, enabling O(1) slot checks and skipping unnecessary row reads during partitioning and rebuilding passes.
2026-06-22 09:54:51 +02:00
Eric Coissac 4c4524766c feat(matrix): add partial group reductions and column persistence
Expands MatrixGroupOps with partial_group_min/max helpers for bitwise reductions and introduces add_col_from methods to persist external vectors as matrix columns. Refactors column aggregation in the partitioner to leverage these group operations directly, replacing iterative row processing with simplified builder lifecycle management and explicit metadata serialization.
2026-06-22 09:49:04 +02:00
Eric Coissac 7eea71fdcd docs(obicompactvec): update API docs and algorithm descriptions
Replace trait-based API documentation with concrete, zero-copy view structs and update all associated diagrams. Refine algorithmic descriptions for sentinel handling, overflow stores, and bulk operations. Clarify temporary file lifecycles and group-chunking strategies to support memory-efficient parallel aggregation.
2026-06-22 09:46:19 +02:00
Eric Coissac f91c5a3f79 refactor(obicompactvec): unify bit and int vector slice views
Refactors column and matrix access to use unified `BitSliceView` and `IntSliceView` abstractions, replacing legacy `PackedCol`/`IntColView` types. Introduces `BitSlice`/`IntSlice` traits for zero-copy, trait-based bitwise and arithmetic operations across persistent and temporary vector types. Removes deprecated in-memory `MemoryBitVec` and `MemoryIntVec` implementations and their tests, while updating dependent crates to use the new view-based API and `BitSliceMut` trait.
2026-06-17 23:51:32 +02:00
Eric Coissac fb4962c4fe refactor: replace in-memory vectors with temp-file-backed storage
Introduces `TempCompactIntVec` and `TempBitVec` as temporary, file-backed intermediates to replace eager in-memory vectors, enabling OS-level paging under memory pressure. Updates the `MatrixGroupOps` trait to return `io::Result` types, allowing proper error propagation and supporting chunked accumulation for large column groups. Includes builder patterns with `.freeze()` finalization, automatic `TempDir` cleanup on drop, and necessary test updates to handle the new fallible signatures. Also fixes `Cargo.toml` section ordering.
2026-06-17 23:36:15 +02:00
Eric Coissac 1d38d87ff9 Add column group operations and mask_with trait
Introduce the `ColGroup` struct and `MatrixGroupOps` trait to manage named subsets of column indices and perform additive aggregations (count, sum, any). Implement these operations for `PersistentBitMatrix` and `PersistentCompactIntMatrix`, applying size-optimized branches for presence counts and direct accumulation for small groups. Additionally, add a `mask_with` trait method that efficiently zero-sets elements based on a mask, optimized for sparse masks with O(n_zeros) complexity. Include comprehensive tests covering overflow handling, slot masking, and result additivity across partitioned data.
2026-06-17 23:28:52 +02:00
Eric Coissac 93559c3294 feat: introduce unified column view types for bit and int matrices
This commit introduces `BitColView` and `IntColView` to abstract over Columnar and Packed storage formats, implementing `BitSlice` and `IntSlice` for uniform column access. It adds `col_view()` accessors to `PersistentBitMatrix` and `PackedCompactIntMatrix`, explicitly panicking on implicit variants. The new types are publicly re-exported, and unit tests are added to validate per-element retrieval, aggregation methods, and parity with the original columnar representation.
2026-06-17 23:24:11 +02:00
Eric Coissac 1f0d77d5bf docs: document compact vector implementation with Mermaid diagrams
Add Mermaid diagrams to visualize the trait hierarchy, compact int storage layout, and SIMD-vectorizable arithmetic operations for MemoryIntVec and PersistentCompactIntVec. Also document concrete type structures and planned layer/partition composition rules to improve documentation clarity.
2026-06-17 23:20:55 +02:00
Eric Coissac eeba43ac4f docs: add technical reference for obicompactvec module
Document the two-tier compact integer encoding, BitSlice/IntSlice trait hierarchy, and SIMD-friendly O(n+k) algorithms. Include details on concrete memory and persistent vector types, matrix aggregation traits, and planned group-filtering APIs.
2026-06-17 23:19:31 +02:00
Eric Coissac 7ed7b26039 perf: optimize vec arithmetic and add overflow tests
Refactor `cmp_scalar`, `min`, `max`, `add`, and `diff` to operate directly on the primary byte array, deferring overflow slot resolution to a secondary pass. This eliminates HashMap lookups in the hot path and enables SIMD vectorization. Add six unit tests to validate correct promotion and demotion between storage slots when values cross the 255 threshold.
2026-06-17 23:18:18 +02:00
Eric Coissac 26de90f18d feat: add iteration and aggregation to compact int vec
Implemented `sum()`, `count_nonzero()`, and `iter()` to complete the numeric vector interface. The builder now computes aggregate values across memory-mapped regions and overflow entries, while the reader delegates these operations to its inherent methods. The iterator provides zero-copy access to underlying `u32` elements.
2026-06-17 23:15:56 +02:00
Eric Coissac 497d250d8a refactor: replace byte-level bit iteration with 64-bit words
Refactor `BitIter` to process `u64` chunks using word-aligned shifts instead of byte-level operations. Introduce a dedicated `MemoryBitIter` for `MemoryBitVec`, updating its `iter()` and `IntoIterator` implementations accordingly. Hide `MemoryBitIter` from the public API to narrow the crate's interface, while leveraging explicit alignment guarantees for safer and more efficient bit extraction.
2026-06-17 23:11:12 +02:00
Eric Coissac aa98e82875 refactor: introduce PackedIntCol view and use iterators
Centralizes overflow handling and improves modularity by replacing manual mmap indexing and row loops with composable iterator patterns. This change leverages Rust's iterator traits for efficient, idiomatic column traversal while encapsulating data access in a dedicated view struct.
2026-06-17 23:09:18 +02:00
Eric Coissac 5ff5b04d2d refactor: replace manual bit ops with BitSlice traits
Refactors bit manipulation and distance calculations to leverage standardized `BitSlice` traits, replacing manual byte/word logic with safer, reusable methods. Extends `IntSlice` and `IntSliceMut` traits to expose direct memory-mapped access and overflow management, enabling efficient bulk data extraction and serialization. Replaces manual bit-shifting loops with optimized table-based unpacking and adds population count and distance metric methods for improved performance. Updates `PersistentBitVecBuilder` with file tracking and safe flushing, and aligns test imports with new trait bounds.
2026-06-17 15:28:44 +02:00
Eric Coissac df7b400fda perf: optimize aggregation with byte-level helpers and direct mmap
Introduce `byte_sum` and `byte_count_nonzero` to efficiently aggregate compact-int byte slices, bypassing per-element decoding and overflow map lookups. Refactor `sum()` and `count_nonzero()` across the matrix, reader, and traits modules to use direct memory-mapped slice iteration and idiomatic Rust iterators. Additionally, expose `MemoryIntIter` publicly and implement `IntoIterator` and `IntSlice` for `MemoryIntVec` to enable standard iteration and delegate aggregation to the new helpers.
2026-06-17 15:21:21 +02:00
Eric Coissac d1717688d2 refactor: extract matrix helpers and improve bit iteration ergonomics
Refactor parallel matrix construction by extracting reusable `pairwise_matrix` and `pairwise2_matrix` helpers, and consolidate binary record deserialization into dedicated parsing functions. Add `set` and `iter` methods to `BitSliceMut` and `MemoryBitVec` for ergonomic bit manipulation and iteration. Standardize JSON field extraction via `meta::field`, expose `MemoryBitIter`, and improve test reliability by automatically cleaning up temporary directories.
2026-06-17 15:15:39 +02:00
Eric Coissac cde6457eea feat: add memory vectors, slice traits, and column extraction methods
Introduce `MemoryBitVec` and `MemoryIntVec` for efficient in-memory storage with hybrid compression and overflow handling. Implement `BitSlice`, `BitSliceMut`, `IntSlice`, and `IntSliceMut` traits across persistent and memory-backed types to enable generic slice operations and bitwise/arithmetic overloads. Add `col_persist` and `col_as_memory` methods to `BitMatrix` and `IntMatrix` for efficient column extraction. Align with the new single-pass rebuild architecture by supporting fast kmer filtering and matrix rebuilding. Includes comprehensive tests and profiling instrumentation for the packing phase.
2026-06-17 15:03:18 +02:00
Eric Coissac b6fcbc545f refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:53:31 +02:00
coissac 9578f991f4 Merge pull request 'Push pslsukyowzrp' (#32) from push-pslsukyowzrp into main
Reviewed-on: #32
2026-06-15 16:29:24 +00:00
Eric Coissac 1cd7916e06 refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:29:04 +02:00
Eric Coissac bc92dc4592 refactor: restructure partitioner with shared utilities and pipeline
This commit restructures the partitioner crate by extracting shared utilities and the `ColBuilder` enum into a new `common` module. It introduces a multi-phase `graph_pipeline` for constructing and materializing De Bruijn graphs, replacing manual graph construction in `index_layer`, `merge_layer`, and `rebuild_layer`. All layer workflows now use centralized `build_graph` and `materialize_layer` abstractions, with standardized error context strings for improved diagnostics.
2026-06-15 14:08:16 +02:00
coissac a9567ad023 Merge pull request 'Push rtnzuqxzmkon' (#31) from push-rtnzuqxzmkon into main
Reviewed-on: #31
2026-06-15 09:40:35 +00:00
Eric Coissac 4a64718fd1 perf: replace partition processing with adaptive NUMA worker pool
Replaces the previous partition processing logic with an adaptive, NUMA-aware multi-threaded worker pool that dynamically scales active threads based on real-time CPU efficiency. Introduces pre-spawned, CPU-pinned threads managed via crossbeam channels and Rayon to optimize memory bandwidth and core utilization. Adds a `max_workers()` accessor to aggregate maximum worker capacity across NUMA nodes and updates diagnostics to report active versus maximum worker counts.
2026-06-15 11:40:14 +02:00
Eric Coissac 7a87e911b6 feat: introduce NUMA-aware PartitionRunner for adaptive parallelism
Replace NUMA-naive Rayon loops and ad-hoc adaptive pools with a unified `PartitionRunner` that manages a NUMA-aware worker pool. The implementation uses pinned Rayon thread pools per node and activates dormant threads based on real-time CPU efficiency metrics. This standardizes partition-level parallelism, optimizes memory locality, and eliminates cross-socket traffic. Includes architecture documentation and updates mkdocs navigation.
2026-06-15 11:34:41 +02:00
coissac 313d73838a Merge pull request 'feat: add pipeline concurrency throttling and HPC build docs' (#30) from push-owwylwtskwzw into main
Reviewed-on: #30
2026-06-15 08:33:41 +00:00
Eric Coissac 175ea5bbd0 feat: add pipeline concurrency throttling and HPC build docs
Introduces a counting semaphore-based throttling mechanism to limit concurrent file I/O and pipeline processing. Replaces custom path wrappers with standardized `Throttled` types across `obikmer` and `obikpartitionner`, ensuring RAII-based resource cleanup and explicit backpressure. Additionally, documents how to redirect Cargo build artifacts to local scratch storage on HPC filesystems to prevent compilation slowdowns.
2026-06-15 10:33:23 +02:00
coissac c6ea0c53e3 Merge pull request 'feat: implement NUMA-aware worker pools for merge command' (#29) from push-wusvurukprsr into main
Reviewed-on: #29
2026-06-14 21:57:21 +00:00
Eric Coissac ea767376bd feat: implement NUMA-aware worker pools for merge command
Replaces the global Rayon pool with per-NUMA-node thread pools that pin worker threads to their respective nodes, leveraging Linux first-touch allocation to reduce cross-NUMA memory contention and improve cache locality. Integrates the `hwlocality` crate with a vendored build, includes graceful fallbacks for single-socket or non-Linux systems, and updates dependency constraints. Also adds installation and architecture documentation, and corrects parallelism detection in the partitioner.
2026-06-14 23:56:52 +02:00
coissac f1d76f3203 Merge pull request 'refactor(merge): extract adaptive worker spawn logic' (#28) from push-yzruqtyqvopm into main
Reviewed-on: #28
2026-06-13 12:56:34 +00:00
Eric Coissac c4071eb450 refactor(merge): extract adaptive worker spawn logic
Centralize inline spawn checks into a `should_spawn_worker` function with adaptive thresholds. The first worker spawns at <95% CPU efficiency, while subsequent workers only trigger if marginal efficiency gain exceeds 25% of the expected `1/n_workers` (minimum 3%). Also increases the spawn poll interval from 10s to 20s.
2026-06-13 14:56:01 +02:00
coissac 817b02cbc1 Merge pull request 'Push zkspuxlpumpw' (#27) from push-zkspuxlpumpw into main
Reviewed-on: #27
2026-06-13 11:25:12 +00:00
Eric Coissac 547cb72d76 refactor: Enforce Rayon parallelism and fix merge_layer concurrency
Updated memory guidelines and feedback docs to explicitly classify intra-partition phases as parallel, correcting prior assumptions of sequential execution. Refactored merge_layer.rs to wrap column builders in Arc<Mutex<ColBuilder>> and use Arc::try_unwrap for safe concurrent access, eliminating race conditions and preventing double-closes during pass2.
2026-06-13 13:24:55 +02:00
Eric Coissac 6d85387077 feat: add performance instrumentation and dynamic worker scaling
This change enhances observability and adaptability in the merge pipeline. Performance timing and debug logging are added to the De Bruijn graph and partition merge layers to track phase durations and pipeline metrics. The merge module replaces blocking receives with timed polls to sample CPU efficiency, dynamically spawning workers when utilization drops below a threshold. A new script is also introduced to parse merge debug logs and generate structured Markdown reports detailing throughput, phase breakdowns, and partition performance.
2026-06-13 13:21:53 +02:00
coissac fb5b53dca9 Merge pull request 'Push ooxwzorvsqvy' (#26) from push-ooxwzorvsqvy into main
Reviewed-on: #26
2026-06-13 09:59:07 +00:00
Eric Coissac fddf630772 style: apply consistent formatting and whitespace normalization
Applies consistent formatting, whitespace normalization, and indentation standardization to `debruijn.rs` and `merge.rs`. Reorganizes imports and downgrades a unitig traversal log from `info!` to `debug!`. No functional logic or runtime behavior is altered.
2026-06-13 11:58:20 +02:00
Eric Coissac bc14346f5f feat: add CPU-aware parallel worker pool for partition merging
Introduce CpuSample to measure process-level CPU efficiency and wall-clock time. Use crossbeam-channel to distribute partition merging tasks to a dynamic worker pool that scales based on CPU utilization, capped at half the available cores. Update diagnostics to track pool usage.
2026-06-13 11:58:20 +02:00
Eric Coissac fb8c6e427c refactor: pass Unitig objects directly instead of raw byte slices
Refactored `try_for_each_unitig` and related pipelines across `obidebruinj` and `obikpartitionner` to accept `Unitig` instances directly. This eliminates manual `Unitig::from_nucleotides()` conversions, simplifies the data flow, and reduces unnecessary allocation overhead.
2026-06-13 11:52:50 +02:00
Eric Coissac 1f336fe496 refactor: replace mutex with channels for parallel debruijn processing
Add `rayon` and `crossbeam-channel` dependencies to support concurrent execution. Replace the synchronous, mutex-protected closure pattern with a channel-based producer-consumer approach using `std::thread::scope`. This decouples unitig iteration from processing, eliminating lock contention and `Mutex` overhead while enabling parallel workloads.
2026-06-13 11:49:27 +02:00
Eric Coissac 5f98d2ef96 refactor: replace explicit collect with Unitig::from_nucleotides
Introduce a thread-local buffer to materialize nucleotide iterators into contiguous slices. Update `try_for_each_unitig` across the debruijn, index, merge, and rebuild layers to directly instantiate `Unitig` via `from_nucleotides()` instead of explicitly collecting iterators. This eliminates intermediate allocations and aligns test code with the new approach.
2026-06-13 11:47:06 +02:00
Eric Coissac 8b563d0804 refactor: migrate pipeline stages and improve graph processing
Refactored neighbor resolution to explicitly track unvisited indices for degree-1 nodes, updated display formatting, and added timing and debug logging to the degree computation routine. Migrated pipeline stages from eager vector returns to explicit flat implementations, enabling backpressure-aware streaming, configurable batch processing, incremental yielding, and progress tracking via a delta channel.
2026-06-13 11:44:17 +02:00
coissac 7208dcbb4a Merge pull request 'refactor: defer SrcLayerData lookups in RawBatch' (#25) from push-nxrynoorswrw into main
Reviewed-on: #25
2026-06-12 20:19:21 +00:00
Eric Coissac 2e69b0b7fe refactor: defer SrcLayerData lookups in RawBatch
Replace eager resolution of `Vec<u32>` values with an `Arc<SrcLayerData>` handle passed alongside `Vec<CanonicalKmer>`. This shifts the lookup logic to the subsequent transform step, reducing memory overhead and enabling shared, thread-safe access to the source layer data.
2026-06-12 22:18:57 +02:00
coissac 9ea1dff5d6 Merge pull request 'Push rwqsmuvystym' (#24) from push-rwqsmuvystym into main
Reviewed-on: #24
2026-06-12 19:33:20 +00:00
Eric Coissac b2c8373586 refactor: parallelize merge layer with WorkerPool pipeline
Replaces the synchronous sequential loop with a multi-threaded pipeline using `WorkerPool` and custom stage macros. Shared mutable state is wrapped in `Arc<Mutex<>>` for thread-safe updates, while pipeline errors are centralized via `Arc<Mutex<Option<String>>>` to propagate failures before thread join.
2026-06-12 21:32:53 +02:00
Eric Coissac ba49af6f9e refactor: parallelize merge and partition logic with obipipeline
Introduce the `obipipeline` dependency and refactor merge and partition logic to leverage parallel execution. Update `merge_partitions` to use rayon with dynamic memory budgeting and concurrency control via a pilot run. Refactor Pass 1 to concurrently read unitigs, filter kmers through a shared `LayeredMap`, and populate the graph safely. Simplify diagnostics to report total kmer counts and replace manual flags with graph length validation.
2026-06-12 21:32:04 +02:00
Eric Coissac 2bc189e962 feat: dynamically compute seed expansion based on RSS
Introduce a `peak_rss_bytes()` utility for accurate per-phase RAM measurement. Replace the genome-length heuristic with a dynamic seed expansion ratio based on actual RSS delta. Explicitly drop the `GraphDeBruijn` instance before MPHF construction to prevent resource contention and ensure proper memory management.
2026-06-12 16:39:38 +02:00
coissac db9c604199 Merge pull request 'feat: enhance memory budgeting and add rebuild diagnostics' (#23) from push-nptzpkomspkv into main
Reviewed-on: #23
2026-06-12 13:21:12 +00:00
Eric Coissac 52fd2cf801 feat: enhance memory budgeting and add rebuild diagnostics
This commit improves memory management by respecting Linux cgroup v1/v2 limits and introduces a configurable memory budget for the new `rebuild` subcommand to prevent OOM during index reconstruction. The rebuild process now supports filtering, compaction, and parallelization. Diagnostic capabilities are expanded with debug-level tracing for partition merges, k-mer expansion tracking, and utility flags for label renaming, matrix size breakdowns, per-genome counts, and partition distribution reporting. Accessor methods for active and remaining memory have also been added to the stats struct.
2026-06-12 15:20:38 +02:00
coissac 97e3fb9761 Merge pull request 'Push ylnwstyzqwrt' (#22) from push-ylnwstyzqwrt into main
Reviewed-on: #22
2026-06-12 10:10:03 +00:00
Eric Coissac b5e027f23b feat: add memory-aware parallel merge scheduling and CLI flags
Introduces a memory-aware scheduling strategy for parallel partition merging that replaces unbounded concurrency with a First-Fit Decreasing approach gated by a thread-safe `MemoryBudget` semaphore. An adaptive expansion factor, seeded by a sequential pilot run, dynamically caps concurrent workers to prevent hashbrown OOMs. Adds a `--budget-fraction` CLI flag to configure RAM allocation, enhances the CLI to accept multiple indexes, and introduces comprehensive partition diagnostics including memory utilization tracking, concurrency metrics, and statistical summaries with ASCII histograms. Updates documentation and navigation accordingly.
2026-06-12 11:44:10 +02:00
Eric Coissac f44fe042bc feat: add parallel k-mer counting and stats CLI
Introduces allocation-free `sum()` and `count_nonzero()` methods for compact integer vectors, extending the `ColumnWeights` trait with `partial_kmer_counts`. Adds parallel partition scanning to the k-mer index for computing per-genome distinct k-mer counts, and exposes a new `--stats` CLI flag to output these statistics as CSV.
2026-06-12 11:29:32 +02:00
coissac 94e0a370b3 Merge pull request 'Push tmpsxsztwpxl' (#21) from push-tmpsxsztwpxl into main
Reviewed-on: #21
2026-06-09 13:31:25 +00:00
Eric Coissac 970460be42 refactor: rename rebuild subcommand to filter
Rename the `rebuild` CLI subcommand to `filter` to better reflect its primary purpose of row-level selection and k-mer filtering. Update all associated CLI arguments, logging, error messages, and module registrations accordingly. Introduce a dedicated `Rebuild` subcommand for index compaction, fully decoupling it from the filtering logic. Also refine related documentation to align with the new naming and semantics.
2026-06-09 15:26:37 +02:00
Eric Coissac e66adef23d feat: add select command for genome column projection and aggregation
Introduces the `select` CLI command to project and aggregate genome-level k-mer data by column. Adds `filter` as an alias for `rebuild`. The implementation uses parallel partition processing, supports metadata-driven grouping with configurable aggregation operators, and performs atomic in-place rewrites or filtered exports. Updates documentation and navigation accordingly.
2026-06-09 15:09:47 +02:00
coissac b0dab452f6 Merge pull request 'refactor: optimize dump partition iteration and add progress tracking' (#20) from push-xqswlxlvmyrq into main
Reviewed-on: #20
2026-06-09 09:34:13 +00:00
Eric Coissac db730e9cf6 refactor: optimize dump partition iteration and add progress tracking
Refactor partition iteration to support a generic `on_partition` callback executed after each parallel partition completes. Split the logic into bounded and unbounded paths; the bounded path uses an `AtomicUsize` to enforce row limits, while the unbounded path eliminates atomic contention to improve throughput. Additionally, integrate a progress bar into the dump command by passing an increment callback to `idx.dump()`, ensuring proper initialization and cleanup.
2026-06-09 11:07:48 +02:00
coissac f65ecd19cc Merge pull request 'Push lrwmyplxxzkn' (#19) from push-lrwmyplxxzkn into main
Reviewed-on: #19
2026-06-09 08:28:20 +00:00
Eric Coissac 7dd8db1409 docs: document conservative rounding strategy for filtering thresholds
Specifies that minimum bounds use ceiling and maximum bounds use floor to enforce strictness. Clarifies that the implementation avoids explicit rounding by directly comparing integer counts against floating-point fractions, which is mathematically equivalent.
2026-06-09 10:26:21 +02:00
Eric Coissac ce45e2fbe1 refactor: centralize k-mer filtering logic and add validation
Refactor shared `FilterArgs` and `build_group_filter` to return a `Result` with explicit validation for fraction bounds, min/max ordering, and count constraints. Update conditional defaults for `--min-frac` and `--max-outgroup-count` to depend on explicit quorum flags, preventing silent configuration conflicts. Update documentation and MkDocs navigation to reflect the new centralized k-mer filtering system across `rebuild`, `dump`, and `unitig` commands.
2026-06-09 10:22:25 +02:00
Eric Coissac 2465cfbc4b Parallelize partition iteration using Rayon
Introduce thread-local `Vec<u8>` buffers to eliminate concurrent I/O contention. Replace the mutable row counter with an `AtomicUsize` and `fetch_update` to enable lock-free early termination when the limit is reached. Collected chunks are then written sequentially to preserve partition ordering.
2026-06-09 10:04:25 +02:00
Eric Coissac d626d42ec7 feat: add --head and --presence-threshold to dump and distance
Introduces `--head N` to the `dump` command for early iteration termination and `--presence-threshold N` to the `distance` command for Jaccard filtering on count indexes. Updates filter defaults to adapt based on explicit ingroup/outgroup declarations. Fixes a Rust type mismatch in the unitig closure and updates partition iteration callbacks to return `bool` for proper early termination support. Documentation is updated accordingly.
2026-06-09 10:04:25 +02:00
161 changed files with 17149 additions and 2951 deletions
Vendored
BIN
View File
Binary file not shown.
+35
View File
@@ -0,0 +1,35 @@
pname: CI
on:
pull_request:
branches: ['main']
jobs:
build:
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-v2-
- name: Build
run: cargo build --release
- name: Test
run: cargo test --release
+127
View File
@@ -0,0 +1,127 @@
name: Release
on:
push:
tags:
- "v*"
jobs:
create-release:
runs-on: ubuntu-latest
outputs:
release_id: ${{ steps.create.outputs.release_id }}
steps:
- uses: actions/checkout@v4
with:
fetch-depth: 0
- name: Create Gitea release
id: create
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
TAG: ${{ github.ref_name }}
run: |
sudo apt-get update -qq && sudo apt-get install -y -qq jq
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
release_id=$(curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
-H "Authorization: token $GITEA_TOKEN" \
-H "Content-Type: application/json" \
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
echo "release_id=$release_id" >> $GITHUB_OUTPUT
build-linux-x86_64:
needs: create-release
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust + zigbuild
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
sudo apt-get update -qq && sudo apt-get install -y -qq jq
pip install ziglang --quiet --break-system-packages
$HOME/.cargo/bin/cargo install cargo-zigbuild
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
- name: Create musl C/C++ wrappers
run: |
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: linux-musl-cargo-
- name: Build static binary
env:
PKG_CONFIG_ALLOW_CROSS: "1"
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
strip /tmp/dist/obikmer-linux-x86_64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
build-macos-arm64:
needs: create-release
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v4
- name: Login to registry
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: macos-arm64-cargo-
- name: Build macOS binary
run: |
CID=$(docker create \
-w /src/src \
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
cargo build --release --target aarch64-apple-darwin --no-default-features)
docker cp . "$CID:/src"
docker start -a "$CID"
STATUS=$(docker wait "$CID")
mkdir -p /tmp/dist
docker cp "$CID:/src/src/target/aarch64-apple-darwin/release/obikmer" /tmp/dist/obikmer-macos-arm64
docker rm "$CID" > /dev/null
[ "$STATUS" -eq 0 ]
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
+17
View File
@@ -8,4 +8,21 @@ data-stress
*.pb
./**/*.json
*.bin
*.log
*.csv
Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
benchmark/specimen_index_presence
benchmark/specimen_index_count
benchmark/global_index_presence
benchmark/all_specific
benchmark/global_index_count
benchmark/stats
benchmark/reference_index
benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
TNT
phyg
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obikmer"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- rust
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+26
View File
@@ -73,3 +73,29 @@ Lors de l'ajout de nouveaux fichiers Markdown dans `docmd/`, mettre à jour la s
---
Je continue à poser mes questions et à guider la discussion.
---
## MCP Tools
**Règle absolue : avant tout travail de code, appeler `mcp__serena__initial_instructions` pour charger les instructions Serena.**
### Hiérarchie des outils pour ce projet Rust
**Navigation et édition de code → serena en priorité**
- Trouver un symbole, une déclaration, les implémentations d'un trait : `mcp__serena__find_symbol`, `mcp__serena__find_declaration`, `mcp__serena__find_implementations`
- Trouver les usages d'un symbole : `mcp__serena__find_referencing_symbols`
- Diagnostics LSP (erreurs de compilation) : `mcp__serena__get_diagnostics_for_file`
- Vue d'ensemble d'un fichier : `mcp__serena__get_symbols_overview`
- Modifier le corps d'une fonction/impl : `mcp__serena__replace_symbol_body`
- Ne pas utiliser `cclsp` quand serena couvre le besoin
**Analyse architecturale → jcodemunch**
- Hotspots, couplage, dead code, dépendances entre modules
- Utiliser avant de refactorer une zone critique
**Raisonnement complexe → sequential-thinking**
- Décisions d'architecture, choix d'algorithme, trade-offs non triviaux
**Documentation de crates → context7**
- Toujours consulter avant d'utiliser une API de bibliothèque externe
+34
View File
@@ -22,6 +22,7 @@ $(MKDOCS): $(VENV)/bin/activate
mkdocs mkdocs-material \
mkdocs-mermaid2-plugin \
mkdocs-bibtex
$(PIP) install --quiet --upgrade InSilicoSeq
# ── obikmer binary ───────────────────────────────────────────────────────────
@@ -62,3 +63,36 @@ clean-doc:
.PHONY: clean
clean: clean-doc
rm -rf $(VENV)
# ── release ───────────────────────────────────────────────────────────────────
CARGO_TOML := $(CARGO_DIR)/obikmer/Cargo.toml
.PHONY: bump-version
bump-version:
@current=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
if [ -n "$(RELEASE)" ]; then \
new_version="$(RELEASE)"; \
else \
major=$$(echo $$current | cut -d. -f1); \
minor=$$(echo $$current | cut -d. -f2); \
patch=$$(echo $$current | cut -d. -f3); \
new_patch=$$((patch + 1)); \
new_version="$$major.$$minor.$$new_patch"; \
fi; \
echo "Version: $$current -> $$new_version"; \
sed -i.bak "s/^version = \"$$current\"/version = \"$$new_version\"/" $(CARGO_TOML) && \
rm $(CARGO_TOML).bak
.PHONY: release
release: bump-version
@jj auto-describe
@jj git push --change @
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
tag_msg="$${notes:-Release v$$new_version}"; \
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
git push origin "v$$new_version"
+15 -2
View File
@@ -51,7 +51,13 @@ Non-ACGT characters act as hard breaks between k-mer segments in all formats.
Runs scatter → dereplicate → count → layered MPHF.
Resumes automatically if interrupted.
merge Merge multiple independently built indexes into one.
rebuild Filter and compact an existing index: apply count thresholds,
Schedules partitions largest-first under a memory budget semaphore
to avoid OOM on machines with many cores. The worst partition runs
alone first to calibrate the expansion estimator; subsequent
partitions run in parallel within the budget.
--budget-fraction F fraction of available RAM to use as budget
(default 0.5; reduce if OOM persists).
filter Filter and compact an existing index: apply count thresholds,
drop layers, rewrite as a single-layer index.
reindex Convert evidence in-place across all layers:
exact (evidence.bin) ↔ approximate (fingerprint.bin).
@@ -74,7 +80,14 @@ Non-ACGT characters act as hard breaks between k-mer segments in all formats.
Diagnostic / pipeline use.
unitig Dump the unitig sequences stored in a built index. Debug use.
utils Miscellaneous utilities.
--new-label NEW=OLD renames a genome label in-place.
--new-label NEW=OLD rename a genome label in-place.
--bits-per-kmer print MPHF / evidence / matrix size breakdown.
--stats per-genome k-mer counts as CSV.
--partition-stats partition size distribution across one or more
indexes (markdown report to stdout). Useful to
diagnose minimizer imbalance before a large merge.
--csv FILE write per-(partition, source) raw data to FILE
(used with --partition-stats).
## Quick start
+230
View File
@@ -0,0 +1,230 @@
# Requires GNU Make >= 4.3 (grouped targets &:) — use gmake on macOS
BINARY := ../src/target/release/obikmer
VENV_PY := ../.venv/bin/python3
GENOMES := $(wildcard genomes/*.fna.gz)
# SPECIMENS, SPECIES, and the full dependency graph are generated by
# make_deps.py from the genome FASTA headers — like .d files in C.
# Make rebuilds deps.mk whenever genomes/ changes and restarts.
-include deps.mk
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
REF_DIST_CSVS := $(addprefix reference_dist/, \
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
euclidean_dist.csv relfreq_euclidean_dist.csv \
hellinger_dist.csv hellinger_euclidean_dist.csv)
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
hamming_dist.csv hamming_nj.nwk)
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
bray_curtis_dist.csv bray_curtis_nj.nwk \
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
euclidean_dist.csv euclidean_nj.nwk \
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
hellinger_dist.csv hellinger_nj.nwk \
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
DIST_COMPARISON := stats/dist_comparison/summary.csv
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
COUNT_STATS := $(SPECIMENS:%=stats/indexing_count/%.stats)
VERIFY_PRESENCE_STATS := $(SPECIMENS:%=stats/verify_presence/%.stats)
VERIFY_COUNT_STATS := $(SPECIMENS:%=stats/verify_count/%.stats)
SPECIFIC_PRESENCE_DONE := $(SPECIES:%=specific_index_presence/%/index.done)
SPECIFIC_PRESENCE_STATS := $(SPECIES:%=stats/specific_kmer_presence/%.stats)
SPECIFIC_COUNT_DONE := $(SPECIES:%=specific_index_count/%/index.done)
SPECIFIC_COUNT_STATS := $(SPECIES:%=stats/specific_kmer_count/%.stats)
SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/reads_R1.fastq.gz)
.NOTPARALLEL:
.PHONY: all simulate reference reference_dist \
obikmer_dist obikmer_dist_presence obikmer_dist_count \
dist_comparison \
index_presence index_count \
aggregate_index_presence aggregate_index_count \
merge_presence merge_count \
verify_presence verify_count \
aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
filter_presence filter_count \
aggregate_filter_presence aggregate_filter_count
verify_merge_presence: stats/verify_merge_presence/current.csv
verify_merge_count: stats/verify_merge_count/current.csv
all: aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
aggregate_filter_presence aggregate_filter_count \
dist_comparison
# ── dependency file ───────────────────────────────────────────────────────────
deps.mk: $(GENOMES)
$(VENV_PY) make_deps.py $^ > $@
# ── simulation ────────────────────────────────────────────────────────────────
# Prerequisites (genome → reads) are in deps.mk; $< is the genome file.
$(SIMULATED_READS):
bash simulate_one.sh $< $(dir $@)
simulate: $(SIMULATED_READS)
# ── reference kmer sets ───────────────────────────────────────────────────────
# Prerequisites (reads → npz) are in deps.mk.
reference_index/%.npz:
bash build_reference.sh $*
reference: $(REF_NPZS)
# ── reference distance matrices ───────────────────────────────────────────────
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
$(VENV_PY) build_reference_dist.py
reference_dist: $(REF_DIST_CSVS)
# ── obikmer distance (presence index) ────────────────────────────────────────
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
mkdir -p obikmer_dist/presence
$(BINARY) distance \
--output obikmer_dist/presence/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_presence
$(BINARY) distance \
--output obikmer_dist/presence/hamming \
--metric hamming --nj \
global_index_presence
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
# ── obikmer distance (count index) ───────────────────────────────────────────
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
mkdir -p obikmer_dist/count
$(BINARY) distance \
--output obikmer_dist/count/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/bray_curtis \
--metric bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_bray_curtis \
--metric relfreq-bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/euclidean \
--metric euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_euclidean \
--metric relfreq-euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger \
--metric hellinger --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger_euclidean \
--metric hellinger-euclidean --nj \
global_index_count
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
obikmer_dist: obikmer_dist_presence obikmer_dist_count
# ── distance comparison ───────────────────────────────────────────────────────
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
dist_comparison: $(DIST_COMPARISON)
# ── per-specimen indexing ─────────────────────────────────────────────────────
# Prerequisites (reads → index.done + .stats) are in deps.mk.
specimen_index_presence/%/index.done \
stats/indexing_presence/%.stats &: $(BINARY)
bash index_one_presence.sh $*
specimen_index_count/%/index.done \
stats/indexing_count/%.stats &: $(BINARY)
bash index_one_count.sh $*
index_presence: $(PRESENCE_DONE)
index_count: $(COUNT_DONE)
# ── indexing stats aggregation ────────────────────────────────────────────────
aggregate_index_presence: $(PRESENCE_STATS)
bash aggregate_stats.sh indexing_presence
aggregate_index_count: $(COUNT_STATS)
bash aggregate_stats.sh indexing_count
# ── global merge ──────────────────────────────────────────────────────────────
global_index_presence/index.done: $(PRESENCE_DONE) $(BINARY)
bash merge_presence.sh
global_index_count/index.done: $(COUNT_DONE) $(BINARY)
bash merge_count.sh
merge_presence: global_index_presence/index.done
merge_count: global_index_count/index.done
# ── per-specimen verification ─────────────────────────────────────────────────
# Prerequisites (index.done + npz → .stats) are in deps.mk.
stats/verify_presence/%.stats:
bash verify_one_presence.sh $*
stats/verify_count/%.stats:
bash verify_one_count.sh $*
verify_presence: $(VERIFY_PRESENCE_STATS)
verify_count: $(VERIFY_COUNT_STATS)
# ── verification stats aggregation ───────────────────────────────────────────
aggregate_verify_presence: $(VERIFY_PRESENCE_STATS)
bash aggregate_stats.sh verify_presence
aggregate_verify_count: $(VERIFY_COUNT_STATS)
bash aggregate_stats.sh verify_count
# ── species-specific indexes ──────────────────────────────────────────────────
# Prerequisites (global index → specific index) are in deps.mk.
specific_index_presence/%/index.done \
stats/specific_kmer_presence/%.stats &: $(BINARY)
bash filter_one_presence.sh $*
specific_index_count/%/index.done \
stats/specific_kmer_count/%.stats &: $(BINARY)
bash filter_one_count.sh $*
filter_presence: $(SPECIFIC_PRESENCE_DONE)
filter_count: $(SPECIFIC_COUNT_DONE)
aggregate_filter_presence: $(SPECIFIC_PRESENCE_STATS)
bash aggregate_stats.sh specific_kmer_presence
aggregate_filter_count: $(SPECIFIC_COUNT_STATS)
bash aggregate_stats.sh specific_kmer_count
# ── merged index verification ─────────────────────────────────────────────────
stats/verify_merge_presence/current.csv: $(REF_NPZS) global_index_presence/index.done
bash verify_merge_presence.sh
stats/verify_merge_count/current.csv: $(REF_NPZS) global_index_count/index.done
bash verify_merge_count.sh
+132
View File
@@ -0,0 +1,132 @@
# Benchmark pipeline
Requires **GNU Make ≥ 4.3** (grouped targets `&:`). On macOS use `gmake`.
```
gmake all # full pipeline
gmake simulate # simulation only
gmake reference # reference kmer sets only
```
## Pipeline overview
```mermaid
flowchart TD
GENOMES["genomes/*.fna.gz"]
BIN["obikmer binary"]
GENOMES --> simulate
simulate --> simdata[("simulated_data/")]
simdata --> reference
reference --> refnpz[("reference_index/*.npz")]
subgraph presence ["Presence track"]
simdata --> index_presence
BIN --> index_presence
index_presence --> pres_done[("specimen_index_presence/")]
index_presence --> pres_istats[("stats/indexing_presence/")]
pres_istats --> aggregate_index_presence
pres_done --> merge_presence
BIN --> merge_presence
merge_presence --> gpres[("global_index_presence/")]
refnpz --> verify_presence
pres_done --> verify_presence
verify_presence --> vpres_stats[("stats/verify_presence/")]
vpres_stats --> aggregate_verify_presence
gpres --> filter_presence
BIN --> filter_presence
filter_presence --> spec_pres[("specific_index_presence/")]
filter_presence --> spec_pres_stats[("stats/specific_kmer_presence/")]
spec_pres_stats --> aggregate_filter_presence
refnpz --> verify_merge_presence
gpres --> verify_merge_presence
verify_merge_presence --> vmp[("stats/verify_merge_presence/")]
end
subgraph count ["Count track"]
simdata --> index_count
BIN --> index_count
index_count --> count_done[("specimen_index_count/")]
index_count --> count_istats[("stats/indexing_count/")]
count_istats --> aggregate_index_count
count_done --> merge_count
BIN --> merge_count
merge_count --> gcount[("global_index_count/")]
refnpz --> verify_count
count_done --> verify_count
verify_count --> vcount_stats[("stats/verify_count/")]
vcount_stats --> aggregate_verify_count
gcount --> filter_count
BIN --> filter_count
filter_count --> spec_count[("specific_index_count/")]
filter_count --> spec_count_stats[("stats/specific_kmer_count/")]
spec_count_stats --> aggregate_filter_count
refnpz --> verify_merge_count
gcount --> verify_merge_count
verify_merge_count --> vmc[("stats/verify_merge_count/")]
end
aggregate_verify_presence --> all
aggregate_verify_count --> all
vmp --> all
vmc --> all
all -. "$(MAKE) re-eval" .-> aggregate_filter_presence
all -. "$(MAKE) re-eval" .-> aggregate_filter_count
```
## Steps
| Target | Script | Description |
|---|---|---|
| `simulate` | `simulate.sh` | Simulate sequencing reads from the reference genomes |
| `reference` | `build_reference.sh` | Build reference kmer sets (`.npz`) from simulation truth |
| `index_presence` | `index_one_presence.sh` | Index each specimen (presence mode) |
| `index_count` | `index_one_count.sh` | Index each specimen (count mode) |
| `aggregate_index_presence` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (presence) |
| `aggregate_index_count` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (count) |
| `merge_presence` | `merge_presence.sh` | Merge all specimen presence indexes into a global index |
| `merge_count` | `merge_count.sh` | Merge all specimen count indexes into a global index |
| `verify_presence` | `verify_one_presence.sh` | Verify each specimen presence index against reference |
| `verify_count` | `verify_one_count.sh` | Verify each specimen count index against reference |
| `aggregate_verify_presence` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (presence) |
| `aggregate_verify_count` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (count) |
| `filter_presence` | `filter_one_presence.sh` | Extract species-specific presence indexes from global index |
| `filter_count` | `filter_one_count.sh` | Extract species-specific count indexes from global index |
| `aggregate_filter_presence` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (presence) |
| `aggregate_filter_count` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (count) |
| `verify_merge_presence` | `verify_merge_presence.sh` | Verify global presence index against all reference sets |
| `verify_merge_count` | `verify_merge_count.sh` | Verify global count index against all reference sets |
## Directory layout
```
benchmark/
├── genomes/ # input reference genomes (.fna.gz)
├── simulated_data/ # generated by simulate
│ └── <species>/<specimen>/
├── reference_index/ # reference kmer sets (.npz)
├── specimen_index_presence/ # per-specimen presence indexes
├── specimen_index_count/ # per-specimen count indexes
├── global_index_presence/ # merged global presence index
├── global_index_count/ # merged global count index
├── specific_index_presence/ # species-specific presence indexes
├── specific_index_count/ # species-specific count indexes
└── stats/ # all benchmark statistics
├── indexing_presence/
├── indexing_count/
├── verify_presence/
├── verify_count/
├── specific_kmer_presence/
├── specific_kmer_count/
├── verify_merge_presence/
└── verify_merge_count/
```
+53
View File
@@ -0,0 +1,53 @@
#!/usr/bin/env bash
# Usage: aggregate_stats.sh TYPE
# TYPE = indexing_presence | indexing_count | verify_presence | verify_count
#
# Reads all stats/TYPE/*.stats files (one CSV data row each, no header).
# Creates a new stats/TYPE/run_NNN.csv only if any .stats file is newer than
# the most recent run CSV (idempotent when nothing changed).
set -euo pipefail
TYPE="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
STATS_DIR="${SCRIPT_DIR}/stats/${TYPE}"
case "${TYPE}" in
indexing_presence|indexing_count)
HEADER="run,species,strain,scatter_wall_s,scatter_rss_b,dereplicate_wall_s,dereplicate_rss_b,count_kmer_wall_s,count_kmer_rss_b,index_wall_s,index_rss_b,total_wall_s,total_rss_b"
;;
verify_presence)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct"
;;
verify_count)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,fn_pct,fp_pct,cm_pct"
;;
specific_kmer_presence|specific_kmer_count)
HEADER="run,species,rebuild_wall_s,rebuild_rss_b,pack_wall_s,pack_rss_b,filter_total_wall_s,filter_total_rss_b,select_wall_s,select_rss_b,select_total_wall_s,select_total_rss_b"
;;
*)
echo "ERROR: unknown stats type '${TYPE}'" >&2
exit 1
;;
esac
# Find most recent existing run CSV (empty string if none).
latest_csv=$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | sort | tail -1)
# Check if any .stats file is newer than the latest run CSV.
if [[ -n "${latest_csv}" ]] && \
[[ -z "$(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' -newer "${latest_csv}" 2>/dev/null)" ]]; then
echo "[${TYPE}] stats up to date (${latest_csv})"
exit 0
fi
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
echo "${HEADER}" >"${CSV}"
# Sort .stats files by name for reproducible row order.
while IFS= read -r stats_file; do
sed "s/^/${run_n},/" "${stats_file}"
done < <(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' | sort) >>"${CSV}"
echo "[${TYPE}] run ${run_n} → ${CSV}"
+137
View File
@@ -0,0 +1,137 @@
#!/usr/bin/env python3
"""Build a reference kmer index from paired-end FASTQ reads.
Extracts canonical kmers — min(kmer, revcomp(kmer)) encoded as uint64 —
counts their abundances, and saves a sorted numpy pair (kmers, counts).
Output .npz arrays
kmers : uint64, sorted ascending — canonical kmer integers
counts : uint32, same order — raw read abundances
"""
import argparse
import gzip
import sys
from collections import defaultdict
import numpy as np
# ── encoding ────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
# Lookup table: revcomp of one byte (4 bases, 8 bits).
# Precomputed once at import time.
_REVCOMP8 = [0] * 256
for _i in range(256):
_rc, _x = 0, _i
for _ in range(4):
_rc = (_rc << 2) | (3 - (_x & 3))
_x >>= 2
_REVCOMP8[_i] = _rc
del _i, _rc, _x
def revcomp_int(kmer: int, k: int) -> int:
"""Reverse-complement of a kmer encoded as an integer (2 bits/base).
Uses byte-level lookup (4 bases at a time) for speed.
"""
rc = 0
bits_left = 2 * k
while bits_left > 0:
chunk = min(8, bits_left)
rc_byte = _REVCOMP8[kmer & 0xFF] >> (8 - chunk)
rc = (rc << chunk) | rc_byte
kmer >>= chunk
bits_left -= chunk
return rc
# ── FASTQ parsing ────────────────────────────────────────────────────────────
def iter_sequences(path: str):
"""Yield raw sequences from a (gzipped) FASTQ file."""
opener = gzip.open if path.endswith('.gz') else open
with opener(path, 'rt') as fh:
while True:
if not fh.readline(): # '@' header
break
seq = fh.readline().rstrip('\n')
fh.readline() # '+'
fh.readline() # quality
yield seq
# ── kmer counting ────────────────────────────────────────────────────────────
def count_kmers(paths: list[str], k: int) -> dict[int, int]:
mask = (1 << (2 * k)) - 1
counts: dict[int, int] = defaultdict(int)
n_reads = 0
for path in paths:
for seq in iter_sequences(path):
n_reads += 1
kmer = 0
run = 0 # consecutive valid bases
for c in seq:
b = _ENCODE.get(c)
if b is None: # N or unexpected character → reset
kmer = 0
run = 0
continue
kmer = ((kmer << 2) | b) & mask
run += 1
if run >= k:
rc = revcomp_int(kmer, k)
counts[kmer if kmer <= rc else rc] += 1
if n_reads % 100_000 == 0:
print(f' {n_reads:,} reads processed, '
f'{len(counts):,} distinct kmers so far',
file=sys.stderr)
print(f' {n_reads:,} reads total, {len(counts):,} distinct kmers',
file=sys.stderr)
return counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reads', nargs='+', metavar='FASTQ',
help='Input reads (FASTQ, gzip OK)')
ap.add_argument('-k', '--kmer-size', type=int, default=31,
metavar='K')
ap.add_argument('--min-abundance', type=int, default=1,
metavar='N', help='Drop kmers with count < N (default 1)')
ap.add_argument('-o', '--output', required=True,
metavar='FILE', help='Output .npz path')
args = ap.parse_args()
print(f'k={args.kmer_size} files={len(args.reads)}', file=sys.stderr)
counts = count_kmers(args.reads, args.kmer_size)
if args.min_abundance > 1:
before = len(counts)
counts = {k: v for k, v in counts.items() if v >= args.min_abundance}
print(f' min-abundance={args.min_abundance}: '
f'{before - len(counts):,} kmers dropped, '
f'{len(counts):,} retained',
file=sys.stderr)
print(f'Sorting and saving → {args.output}', file=sys.stderr)
kmers_arr = np.fromiter(sorted(counts), dtype=np.uint64, count=len(counts))
counts_arr = np.array([counts[int(k)] for k in kmers_arr], dtype=np.uint32)
np.savez_compressed(args.output, kmers=kmers_arr, counts=counts_arr)
print(f'Done {len(kmers_arr):,} kmers → {args.output}', file=sys.stderr)
if __name__ == '__main__':
main()
+39
View File
@@ -0,0 +1,39 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
SIMDATA_DIR="${SCRIPT_DIR}/simulated_data"
REF_DIR="${SCRIPT_DIR}/reference_index"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
BUILD_PY="${SCRIPT_DIR}/build_reference.py"
KMER_SIZE="${KMER_SIZE:-31}"
MIN_ABUNDANCE="${MIN_ABUNDANCE:-1}"
mkdir -p "${REF_DIR}"
for species_dir in "${SIMDATA_DIR}"/*/; do
[[ -d "${species_dir}" ]] || continue
species=$(basename "${species_dir}")
for strain_dir in "${species_dir}"*/; do
[[ -d "${strain_dir}" ]] || continue
strain=$(basename "${strain_dir}")
r1="${strain_dir}/reads_R1.fastq.gz"
r2="${strain_dir}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "SKIP ${species}--${strain}: reads not found" >&2
continue
fi
out="${REF_DIR}/${species}--${strain}.npz"
echo "[${species}--${strain}] → ${out}"
"${PYTHON}" "${BUILD_PY}" \
--kmer-size "${KMER_SIZE}" \
--min-abundance "${MIN_ABUNDANCE}" \
--output "${out}" \
"${r1}" "${r2}"
done
done
+226
View File
@@ -0,0 +1,226 @@
#!/usr/bin/env python3
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
and writes one CSV per metric to reference_dist/.
Output CSV format matches `obikmer distance --output`:
- first row: "genome", then specimen names
- subsequent rows: specimen name, then float or int values
Metrics written
jaccard_dist.csv Jaccard distance (presence/absence)
shared_kmers.csv Shared-kmer count matrix (intersection size)
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
euclidean_dist.csv Euclidean distance (raw counts)
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
hellinger_dist.csv Hellinger distance
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
"""
import argparse
import sys
from pathlib import Path
import numpy as np
# ── pairwise helpers ──────────────────────────────────────────────────────────
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
"""
pos = np.searchsorted(a_kmers, b_kmers)
pos = np.clip(pos, 0, len(a_kmers) - 1)
mask = a_kmers[pos] == b_kmers
idx_b = np.where(mask)[0]
idx_a = pos[idx_b]
return idx_a, idx_b
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
"""Compute all pairwise distance matrices at once.
Returns a dict metric_name → ndarray (n×n float64 or int64).
Each specimen dict has keys: name, kmers, counts.
"""
n = len(specimens)
# Pre-compute per-specimen scalars
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
# Per-specimen sum-of-squares (for Euclidean decomposition)
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
# Allocate output matrices
shared_mat = np.zeros((n, n), dtype=np.uint64)
hamming_mat = np.zeros((n, n), dtype=np.float64)
jaccard_mat = np.zeros((n, n), dtype=np.float64)
bray_mat = np.zeros((n, n), dtype=np.float64)
relfreq_bray = np.zeros((n, n), dtype=np.float64)
euclidean_mat = np.zeros((n, n), dtype=np.float64)
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
hellinger_mat = np.zeros((n, n), dtype=np.float64)
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
for i in range(n):
a_km = specimens[i]['kmers']
a_ct = specimens[i]['counts'].astype(np.float64)
sa = float(count_sums[i])
na = int(kmer_counts[i])
for j in range(i + 1, n):
b_km = specimens[j]['kmers']
b_ct = specimens[j]['counts'].astype(np.float64)
sb = float(count_sums[j])
nb = int(kmer_counts[j])
idx_a, idx_b = shared_indices(a_km, b_km)
inter = len(idx_a)
ca_sh = a_ct[idx_a]
cb_sh = b_ct[idx_b]
# ── Presence metrics ──────────────────────────────────────────────
union = na + nb - inter
jac = (1.0 - inter / union) if union else 0.0
hamming = float(na + nb - 2 * inter) # |A Δ B|
# ── Count metrics ─────────────────────────────────────────────────
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
sum_min = np.minimum(ca_sh, cb_sh).sum()
denom_bc = sa + sb
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
if sa and sb:
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
else:
rfb = 0.0
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
cross = (ca_sh * cb_sh).sum()
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
eucl = np.sqrt(max(eucl_partial, 0.0))
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
if sa and sb:
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
rfe_partial = (sq_sums[i] / sa**2
+ sq_sums[j] / sb**2
- 2.0 * rf_cross)
rfe = np.sqrt(max(rfe_partial, 0.0))
else:
rfe = 0.0
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
if sa and sb:
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
else:
hell_partial = 0.0
sq2 = np.sqrt(2.0)
hell = np.sqrt(hell_partial) / sq2
hell_euc = np.sqrt(hell_partial)
# ── Fill symmetric matrices ───────────────────────────────────────
for mat, val in [
(shared_mat, inter),
(hamming_mat, hamming),
(jaccard_mat, jac),
(bray_mat, bc),
(relfreq_bray, rfb),
(euclidean_mat, eucl),
(relfreq_eucl, rfe),
(hellinger_mat, hell),
(hell_eucl_mat, hell_euc),
]:
mat[i, j] = val
mat[j, i] = val
return {
'shared_kmers': shared_mat,
'hamming_dist': hamming_mat,
'jaccard_dist': jaccard_mat,
'bray_curtis_dist': bray_mat,
'relfreq_bray_curtis_dist': relfreq_bray,
'euclidean_dist': euclidean_mat,
'relfreq_euclidean_dist': relfreq_eucl,
'hellinger_dist': hellinger_mat,
'hellinger_euclidean_dist': hell_eucl_mat,
}
# ── I/O ───────────────────────────────────────────────────────────────────────
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
with path.open('w') as fh:
fh.write('genome,' + ','.join(labels) + '\n')
for i, label in enumerate(labels):
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
fh.write(f'{label},{row}\n')
print(f' → {path}', file=sys.stderr)
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--ref-dir', default='reference_index',
help='Directory with per-specimen .npz files (default: reference_index)')
ap.add_argument('--out-dir', default='reference_dist',
help='Output directory for CSV files (default: reference_dist)')
args = ap.parse_args()
ref_dir = Path(args.ref_dir)
out_dir = Path(args.out_dir)
out_dir.mkdir(exist_ok=True)
npz_files = sorted(ref_dir.glob('*.npz'))
if not npz_files:
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
sys.exit(1)
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
specimens = []
for f in npz_files:
data = np.load(f)
specimens.append({
'name': f.stem,
'kmers': data['kmers'],
'counts': data['counts'],
})
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
labels = [s['name'] for s in specimens]
n = len(labels)
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
matrices = pairwise_stats(specimens)
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
print('\nDone.', file=sys.stderr)
if __name__ == '__main__':
main()
+182
View File
@@ -0,0 +1,182 @@
#!/usr/bin/env python3
"""Compare all reference distance matrices against obikmer distance outputs.
Reads from:
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
obikmer_dist/ — matrices produced by `obikmer distance`
Handles label reordering: both matrices are sorted by genome label before
element-wise comparison, so column/row order differences are irrelevant.
Output: stats/dist_comparison/summary.csv
comparison,max_abs,mean_abs,rmse,n_pairs,status
"""
import csv
import sys
from pathlib import Path
import numpy as np
# ── CSV loading ───────────────────────────────────────────────────────────────
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
with path.open() as fh:
reader = csv.reader(fh)
header = next(reader)[1:] # skip 'genome' column
raw: dict[str, list[float]] = {}
for row in reader:
raw[row[0]] = [float(x) for x in row[1:]]
label_to_col = {h: i for i, h in enumerate(header)}
labels = sorted(raw.keys())
n = len(labels)
mat = np.zeros((n, n), dtype=np.float64)
for i, ri in enumerate(labels):
for j, cj in enumerate(labels):
mat[i, j] = raw[ri][label_to_col[cj]]
return labels, mat
# ── comparison ────────────────────────────────────────────────────────────────
def compare(label: str,
ref_path: Path,
obi_path: Path,
tol: float = 1e-4) -> dict:
if not ref_path.exists():
return {'comparison': label, 'status': 'REF_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
if not obi_path.exists():
return {'comparison': label, 'status': 'OBI_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
ref_labels, ref_mat = load_matrix(ref_path)
obi_labels, obi_mat = load_matrix(obi_path)
if ref_labels != obi_labels:
only_ref = sorted(set(ref_labels) - set(obi_labels))
only_obi = sorted(set(obi_labels) - set(ref_labels))
print(f' [{label}] label mismatch — '
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
return {'comparison': label, 'status': 'LABEL_MISMATCH',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
n = len(ref_labels)
# Off-diagonal mask
mask = ~np.eye(n, dtype=bool)
diff = np.abs(ref_mat[mask] - obi_mat[mask])
n_pairs = diff.size
max_abs = float(diff.max())
mean_abs = float(diff.mean())
rmse = float(np.sqrt((diff ** 2).mean()))
status = 'PASS' if max_abs <= tol else 'FAIL'
print(f' [{label}] n={n_pairs} '
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
file=sys.stderr)
return {
'comparison': label,
'max_abs': f'{max_abs:.6e}',
'mean_abs': f'{mean_abs:.6e}',
'rmse': f'{rmse:.6e}',
'n_pairs': str(n_pairs),
'status': status,
}
# ── comparison table ──────────────────────────────────────────────────────────
# (label, ref_csv, obikmer_csv)
# The reference jaccard/shared is presence-based, which should match both
# presence/jaccard and count/jaccard (threshold=1).
COMPARISONS = [
# ── presence index ────────────────────────────────────────────────────────
('presence/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/presence/jaccard_dist.csv'),
('presence/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/presence/jaccard_shared.csv'),
('presence/hamming_dist',
'reference_dist/hamming_dist.csv',
'obikmer_dist/presence/hamming_dist.csv'),
# ── count index (jaccard cross-check) ─────────────────────────────────────
('count/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/count/jaccard_dist.csv'),
('count/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/count/jaccard_shared.csv'),
# ── count index (count-based metrics) ────────────────────────────────────
('count/bray_curtis_dist',
'reference_dist/bray_curtis_dist.csv',
'obikmer_dist/count/bray_curtis_dist.csv'),
('count/relfreq_bray_curtis_dist',
'reference_dist/relfreq_bray_curtis_dist.csv',
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
('count/euclidean_dist',
'reference_dist/euclidean_dist.csv',
'obikmer_dist/count/euclidean_dist.csv'),
('count/relfreq_euclidean_dist',
'reference_dist/relfreq_euclidean_dist.csv',
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
('count/hellinger_dist',
'reference_dist/hellinger_dist.csv',
'obikmer_dist/count/hellinger_dist.csv'),
('count/hellinger_euclidean_dist',
'reference_dist/hellinger_euclidean_dist.csv',
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
]
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
import argparse
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--tol', type=float, default=1e-4,
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
help='Output summary CSV path')
args = ap.parse_args()
out_path = Path(args.out)
out_path.parent.mkdir(parents=True, exist_ok=True)
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
rows = []
for label, ref, obi in COMPARISONS:
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
with out_path.open('w', newline='') as fh:
w = csv.DictWriter(fh, fieldnames=fields)
w.writeheader()
w.writerows(rows)
print(f'\n→ {out_path}', file=sys.stderr)
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
if n_fail:
sys.exit(1)
if __name__ == '__main__':
main()
+199
View File
@@ -0,0 +1,199 @@
SPECIMENS := Escherichia_coli--K-12_MG1655 Escherichia_coli--EDL933 Salmonella_enterica--LT2 Escherichia_coli--CFT073 Bacillus_subtilis--168 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Saccharolobus_islandicus--M.16.4 Acidobacterium_capsulatum--ATCC_51196 Salmonella_enterica--AKU_12601 Proteus_mirabilis--HI4320 Salmonella_enterica--CT18 Klebsiella_pneumoniae--HS11286 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Klebsiella_pneumoniae--ATCC_13883 Yersinia_ruckeri--YRB Candidozyma_auris--GCF_003013715.1_ASM301371v2
SPECIES := Escherichia_coli Salmonella_enterica Bacillus_subtilis Shouchella_clausii Klebsiella_pneumoniae Opitutus_terrae Saccharolobus_islandicus Acidobacterium_capsulatum Proteus_mirabilis Wolbachia_endosymbiont Yersinia_ruckeri Candidozyma_auris
# Escherichia_coli--K-12_MG1655
simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz: genomes/GCF_000005845.2_ASM584v2_genomic.fna.gz
reference_index/Escherichia_coli--K-12_MG1655.npz: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done stats/indexing_presence/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_MG1655/index.done stats/indexing_count/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done
stats/verify_count/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_count/Escherichia_coli--K-12_MG1655/index.done
# Escherichia_coli--EDL933
simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz: genomes/GCF_000006665.1_ASM666v1_genomic.fna.gz
reference_index/Escherichia_coli--EDL933.npz: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--EDL933/index.done stats/indexing_presence/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--EDL933/index.done stats/indexing_count/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_presence/Escherichia_coli--EDL933/index.done
stats/verify_count/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_count/Escherichia_coli--EDL933/index.done
# Salmonella_enterica--LT2
simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz: genomes/GCF_000006945.2_ASM694v2_genomic.fna.gz
reference_index/Salmonella_enterica--LT2.npz: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--LT2/index.done stats/indexing_presence/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--LT2/index.done stats/indexing_count/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_presence/Salmonella_enterica--LT2/index.done
stats/verify_count/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_count/Salmonella_enterica--LT2/index.done
# Escherichia_coli--CFT073
simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz: genomes/GCF_000007445.1_ASM744v1_genomic.fna.gz
reference_index/Escherichia_coli--CFT073.npz: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--CFT073/index.done stats/indexing_presence/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--CFT073/index.done stats/indexing_count/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_presence/Escherichia_coli--CFT073/index.done
stats/verify_count/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_count/Escherichia_coli--CFT073/index.done
# Bacillus_subtilis--168
simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz: genomes/GCF_000009045.1_ASM904v1_genomic.fna.gz
reference_index/Bacillus_subtilis--168.npz: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_presence/Bacillus_subtilis--168/index.done stats/indexing_presence/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_count/Bacillus_subtilis--168/index.done stats/indexing_count/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
stats/verify_presence/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_presence/Bacillus_subtilis--168/index.done
stats/verify_count/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_count/Bacillus_subtilis--168/index.done
# Salmonella_enterica--P125109
simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz: genomes/GCF_000009505.1_ASM950v1_genomic.fna.gz
reference_index/Salmonella_enterica--P125109.npz: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--P125109/index.done stats/indexing_presence/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--P125109/index.done stats/indexing_count/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_presence/Salmonella_enterica--P125109/index.done
stats/verify_count/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_count/Salmonella_enterica--P125109/index.done
# Shouchella_clausii--KSM-K16
simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz: genomes/GCF_000009825.1_ASM982v1_genomic.fna.gz
reference_index/Shouchella_clausii--KSM-K16.npz: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_presence/Shouchella_clausii--KSM-K16/index.done stats/indexing_presence/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_count/Shouchella_clausii--KSM-K16/index.done stats/indexing_count/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
stats/verify_presence/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_presence/Shouchella_clausii--KSM-K16/index.done
stats/verify_count/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_count/Shouchella_clausii--KSM-K16/index.done
# Escherichia_coli--K-12_W3110
simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz: genomes/GCF_000010245.2_ASM1024v1_genomic.fna.gz
reference_index/Escherichia_coli--K-12_W3110.npz: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_W3110/index.done stats/indexing_presence/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_W3110/index.done stats/indexing_count/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_presence/Escherichia_coli--K-12_W3110/index.done
stats/verify_count/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_count/Escherichia_coli--K-12_W3110/index.done
# Klebsiella_pneumoniae--MGH_78578
simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz: genomes/GCF_000016305.1_ASM1630v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--MGH_78578.npz: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_presence/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_count/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done
stats/verify_count/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done
# Opitutus_terrae--PB90-1
simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz: genomes/GCF_000019965.1_ASM1996v1_genomic.fna.gz
reference_index/Opitutus_terrae--PB90-1.npz: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_presence/Opitutus_terrae--PB90-1/index.done stats/indexing_presence/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_count/Opitutus_terrae--PB90-1/index.done stats/indexing_count/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
stats/verify_presence/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_presence/Opitutus_terrae--PB90-1/index.done
stats/verify_count/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_count/Opitutus_terrae--PB90-1/index.done
# Saccharolobus_islandicus--M.16.4
simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz: genomes/GCF_000022445.1_ASM2244v1_genomic.fna.gz
reference_index/Saccharolobus_islandicus--M.16.4.npz: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_presence/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_count/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
stats/verify_presence/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done
stats/verify_count/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done
# Acidobacterium_capsulatum--ATCC_51196
simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz: genomes/GCF_000022565.1_ASM2256v1_genomic.fna.gz
reference_index/Acidobacterium_capsulatum--ATCC_51196.npz: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_presence/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_count/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
stats/verify_presence/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done
stats/verify_count/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done
# Salmonella_enterica--AKU_12601
simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz: genomes/GCF_000026565.1_ASM2656v1_genomic.fna.gz
reference_index/Salmonella_enterica--AKU_12601.npz: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--AKU_12601/index.done stats/indexing_presence/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--AKU_12601/index.done stats/indexing_count/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_presence/Salmonella_enterica--AKU_12601/index.done
stats/verify_count/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_count/Salmonella_enterica--AKU_12601/index.done
# Proteus_mirabilis--HI4320
simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz: genomes/GCF_000069965.1_ASM6996v1_genomic.fna.gz
reference_index/Proteus_mirabilis--HI4320.npz: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_presence/Proteus_mirabilis--HI4320/index.done stats/indexing_presence/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_count/Proteus_mirabilis--HI4320/index.done stats/indexing_count/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
stats/verify_presence/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_presence/Proteus_mirabilis--HI4320/index.done
stats/verify_count/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_count/Proteus_mirabilis--HI4320/index.done
# Salmonella_enterica--CT18
simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz: genomes/GCF_000195995.1_ASM19599v1_genomic.fna.gz
reference_index/Salmonella_enterica--CT18.npz: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--CT18/index.done stats/indexing_presence/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--CT18/index.done stats/indexing_count/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_presence/Salmonella_enterica--CT18/index.done
stats/verify_count/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_count/Salmonella_enterica--CT18/index.done
# Klebsiella_pneumoniae--HS11286
simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz: genomes/GCF_000240185.1_ASM24018v2_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--HS11286.npz: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_presence/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_count/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done
stats/verify_count/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done
# Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1
simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz: genomes/GCF_000306885.1_ASM30688v1_genomic.fna.gz
reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
stats/verify_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
stats/verify_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
# Klebsiella_pneumoniae--ATCC_13883
simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz: genomes/GCF_000742135.1_ASM74213v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--ATCC_13883.npz: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_presence/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_count/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done
stats/verify_count/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done
# Yersinia_ruckeri--YRB
simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz: genomes/GCF_000834255.1_ASM83425v1_genomic.fna.gz
reference_index/Yersinia_ruckeri--YRB.npz: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_presence/Yersinia_ruckeri--YRB/index.done stats/indexing_presence/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_count/Yersinia_ruckeri--YRB/index.done stats/indexing_count/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
stats/verify_presence/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_presence/Yersinia_ruckeri--YRB/index.done
stats/verify_count/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_count/Yersinia_ruckeri--YRB/index.done
# Candidozyma_auris--GCF_003013715.1_ASM301371v2
simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz: genomes/GCF_003013715.1_ASM301371v2_genomic.fna.gz
reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
stats/verify_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
stats/verify_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
# Escherichia_coli
specific_index_presence/Escherichia_coli/index.done stats/specific_kmer_presence/Escherichia_coli.stats: global_index_presence/index.done
specific_index_count/Escherichia_coli/index.done stats/specific_kmer_count/Escherichia_coli.stats: global_index_count/index.done
# Salmonella_enterica
specific_index_presence/Salmonella_enterica/index.done stats/specific_kmer_presence/Salmonella_enterica.stats: global_index_presence/index.done
specific_index_count/Salmonella_enterica/index.done stats/specific_kmer_count/Salmonella_enterica.stats: global_index_count/index.done
# Bacillus_subtilis
specific_index_presence/Bacillus_subtilis/index.done stats/specific_kmer_presence/Bacillus_subtilis.stats: global_index_presence/index.done
specific_index_count/Bacillus_subtilis/index.done stats/specific_kmer_count/Bacillus_subtilis.stats: global_index_count/index.done
# Shouchella_clausii
specific_index_presence/Shouchella_clausii/index.done stats/specific_kmer_presence/Shouchella_clausii.stats: global_index_presence/index.done
specific_index_count/Shouchella_clausii/index.done stats/specific_kmer_count/Shouchella_clausii.stats: global_index_count/index.done
# Klebsiella_pneumoniae
specific_index_presence/Klebsiella_pneumoniae/index.done stats/specific_kmer_presence/Klebsiella_pneumoniae.stats: global_index_presence/index.done
specific_index_count/Klebsiella_pneumoniae/index.done stats/specific_kmer_count/Klebsiella_pneumoniae.stats: global_index_count/index.done
# Opitutus_terrae
specific_index_presence/Opitutus_terrae/index.done stats/specific_kmer_presence/Opitutus_terrae.stats: global_index_presence/index.done
specific_index_count/Opitutus_terrae/index.done stats/specific_kmer_count/Opitutus_terrae.stats: global_index_count/index.done
# Saccharolobus_islandicus
specific_index_presence/Saccharolobus_islandicus/index.done stats/specific_kmer_presence/Saccharolobus_islandicus.stats: global_index_presence/index.done
specific_index_count/Saccharolobus_islandicus/index.done stats/specific_kmer_count/Saccharolobus_islandicus.stats: global_index_count/index.done
# Acidobacterium_capsulatum
specific_index_presence/Acidobacterium_capsulatum/index.done stats/specific_kmer_presence/Acidobacterium_capsulatum.stats: global_index_presence/index.done
specific_index_count/Acidobacterium_capsulatum/index.done stats/specific_kmer_count/Acidobacterium_capsulatum.stats: global_index_count/index.done
# Proteus_mirabilis
specific_index_presence/Proteus_mirabilis/index.done stats/specific_kmer_presence/Proteus_mirabilis.stats: global_index_presence/index.done
specific_index_count/Proteus_mirabilis/index.done stats/specific_kmer_count/Proteus_mirabilis.stats: global_index_count/index.done
# Wolbachia_endosymbiont
specific_index_presence/Wolbachia_endosymbiont/index.done stats/specific_kmer_presence/Wolbachia_endosymbiont.stats: global_index_presence/index.done
specific_index_count/Wolbachia_endosymbiont/index.done stats/specific_kmer_count/Wolbachia_endosymbiont.stats: global_index_count/index.done
# Yersinia_ruckeri
specific_index_presence/Yersinia_ruckeri/index.done stats/specific_kmer_presence/Yersinia_ruckeri.stats: global_index_presence/index.done
specific_index_count/Yersinia_ruckeri/index.done stats/specific_kmer_count/Yersinia_ruckeri.stats: global_index_count/index.done
# Candidozyma_auris
specific_index_presence/Candidozyma_auris/index.done stats/specific_kmer_presence/Candidozyma_auris.stats: global_index_presence/index.done
specific_index_count/Candidozyma_auris/index.done stats/specific_kmer_count/Candidozyma_auris.stats: global_index_count/index.done
+48
View File
@@ -0,0 +1,48 @@
#!/usr/bin/env bash
set -euo pipefail
assemblies=(
GCF_000005845.2
GCF_000010245.2
GCF_000007445.1
GCF_000006665.1
GCF_000006945.2
GCF_000195995.1
GCF_000009505.1
GCF_000026565.1
GCF_000016305.1
GCF_000019965.1
GCF_000240185.1
GCF_000742135.1
GCF_000069965.1
GCF_000022565.1
GCF_000306885.1
GCF_003013715.1
GCF_000009045.1
GCF_000009825.1
GCF_000022445.1
GCF_000834255.1
)
mkdir -p genomes
for acc in "${assemblies[@]}"; do
echo "Downloading ${acc}"
datasets download genome accession "${acc}" \
--include genome \
--filename "${acc}.zip"
unzip -q "${acc}.zip" -d "${acc}"
find "${acc}" -name "*.fna" |
while read file; do
obiconvert -Z ${file} >genomes/$(basename ${file}).gz
done
rm -rf "${acc}" "${acc}.zip"
done
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_count.sh SPECIES
# Filters global_index_count to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_count/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_count/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_count"
OUTPUT="${SCRIPT_DIR}/specific_index_count/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_count"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (count) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_presence.sh SPECIES
# Filters global_index_presence to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_presence/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_presence/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_presence"
OUTPUT="${SCRIPT_DIR}/specific_index_presence/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_presence"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (presence) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
# Usage: index_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_count/SPECIMEN/index.done (written by obikmer)
# stats/indexing_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (count) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--with-counts \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+102
View File
@@ -0,0 +1,102 @@
#!/usr/bin/env bash
# Usage: index_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_presence/SPECIMEN/index.done (written by obikmer)
# stats/indexing_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (presence) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+118
View File
@@ -0,0 +1,118 @@
#!/usr/bin/env python3
"""Generate deps.mk — pure dependency declarations for the benchmark pipeline.
Like C .d files: only target: prerequisites lines, no recipes.
Recipes stay in the Makefile as generic rules.
"""
import gzip
import re
import sys
from pathlib import Path
STOP_WORDS = {'complete', 'chromosome', 'whole', 'sequence', 'genome',
'endosymbiont', 'of'}
STOP_PREFIXES = ('scaffold', 'contig', 'plasmid')
def is_stop(tok):
t = tok.lower()
return t in STOP_WORDS or any(t.startswith(p) for p in STOP_PREFIXES)
def sanitize(s):
return re.sub(r'[^A-Za-z0-9._-]', '_', s).strip('_')
def collect_tokens(text):
parts = []
for tok in text.split():
tok = tok.rstrip(',.')
if is_stop(tok):
break
parts.append(sanitize(tok))
return '_'.join(filter(None, parts))
def parse_organism(defn, gcf_id):
words = defn.split()
species = sanitize(words[0] + '_' + words[1])
m = re.search(r'\bstr\.\s+(\S+)(?:\s+substr\.\s+(\S+))?', defn)
if m:
strain = sanitize(m.group(1))
if m.group(2):
strain += '_' + sanitize(m.group(2))
return species, strain
m = re.search(r'\bstrain\b\s+(.*)', defn)
if m:
strain = collect_tokens(m.group(1))
if strain:
return species, strain
remainder = re.sub(r'^\S+ \S+\s*', '', defn)
remainder = re.sub(r'^subsp\.\s+\S+\s*', '', remainder)
remainder = re.sub(r'^serovar\s+\S+\s*', '', remainder)
strain = collect_tokens(remainder)
return species, strain if strain else gcf_id
def first_definition(path):
with gzip.open(path, 'rt') as fh:
for line in fh:
if line.startswith('>'):
m = re.search(r'"definition":"([^"]*)"', line)
return m.group(1) if m else line[1:].split()[0]
return Path(path).stem
def main():
entries = [] # (specimen, species, sim_dir, genome_path)
species_seen = []
for path in sorted(sys.argv[1:]):
gcf_id = Path(path).name.replace('_genomic.fna.gz', '')
defn = first_definition(path)
sp, st = parse_organism(defn, gcf_id)
specimen = f'{sp}--{st}'
sim_dir = f'simulated_data/{sp}/{st}'
entries.append((specimen, sp, sim_dir, path))
if sp not in species_seen:
species_seen.append(sp)
specimens = [e[0] for e in entries]
print('SPECIMENS :=', ' '.join(specimens))
print('SPECIES :=', ' '.join(species_seen))
for specimen, species, sim_dir, genome in entries:
reads = f'{sim_dir}/reads_R1.fastq.gz'
p_done = f'specimen_index_presence/{specimen}/index.done'
p_stats = f'stats/indexing_presence/{specimen}.stats'
c_done = f'specimen_index_count/{specimen}/index.done'
c_stats = f'stats/indexing_count/{specimen}.stats'
ref = f'reference_index/{specimen}.npz'
vp = f'stats/verify_presence/{specimen}.stats'
vc = f'stats/verify_count/{specimen}.stats'
print()
print(f'# {specimen}')
print(f'{reads}: {genome}')
print(f'{ref}: {reads}')
print(f'{p_done} {p_stats}: {reads}')
print(f'{c_done} {c_stats}: {reads}')
print(f'{vp}: {ref} {p_done}')
print(f'{vc}: {ref} {c_done}')
print()
for sp in species_seen:
sp_done = f'specific_index_presence/{sp}/index.done'
sp_stats = f'stats/specific_kmer_presence/{sp}.stats'
sc_done = f'specific_index_count/{sp}/index.done'
sc_stats = f'stats/specific_kmer_count/{sp}.stats'
print(f'# {sp}')
print(f'{sp_done} {sp_stats}: global_index_presence/index.done')
print(f'{sc_done} {sc_stats}: global_index_count/index.done')
if __name__ == '__main__':
main()
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_count"
OUTPUT="${SCRIPT_DIR}/global_index_count"
STATS_DIR="${SCRIPT_DIR}/stats/merge_count"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} count indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n} → ${CSV}"
+104
View File
@@ -0,0 +1,104 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_presence"
OUTPUT="${SCRIPT_DIR}/global_index_presence"
STATS_DIR="${SCRIPT_DIR}/stats/merge_presence"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} presence indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
--force-presence \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n} → ${CSV}"
+12
View File
@@ -0,0 +1,12 @@
#!/usr/bin/env bash
# Simulate all genomes. Delegates to simulate_one.sh per genome.
# Prefer running via `gmake simulate` which handles individual dependencies.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
for genome_file in "${SCRIPT_DIR}"/genomes/*.fna.gz; do
out_dir=$("${SCRIPT_DIR}/../.venv/bin/python3" "${SCRIPT_DIR}/make_deps.py" \
--dir-for "${genome_file}")
bash "${SCRIPT_DIR}/simulate_one.sh" "${genome_file}" "${out_dir}"
done
+33
View File
@@ -0,0 +1,33 @@
#!/usr/bin/env bash
# Usage: simulate_one.sh genome.fna.gz output_dir
# Simulates paired-end HiSeq reads for a single genome.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
ISS="${SCRIPT_DIR}/../.venv/bin/iss"
COVERAGE=15
READ_LENGTH=150
CPUS="${CPUS:-$(sysctl -n hw.logicalcpu 2>/dev/null || nproc 2>/dev/null || echo 2)}"
genome_file="$1"
out_dir="$2"
mkdir -p "${out_dir}"
tmp_fasta=$(mktemp "${TMPDIR:-/tmp}/obikmer_XXXXXX.fna")
trap 'rm -f "${tmp_fasta}"' EXIT
gzip -dc "${genome_file}" > "${tmp_fasta}"
genome_size=$(grep -v "^>" "${tmp_fasta}" | tr -d '[:space:]' | wc -c | tr -d ' ')
n_reads=$(python3 -c "import math; print(math.ceil(${COVERAGE} * ${genome_size} / (2 * ${READ_LENGTH})))")
echo "[${out_dir}] genome=${genome_size} bp → ${n_reads} read pairs (${COVERAGE}x HiSeq)"
"${ISS}" generate \
--genomes "${tmp_fasta}" \
--model HiSeq \
--n_reads "${n_reads}" \
--cpus "${CPUS}" \
--compress \
--output "${out_dir}/reads"
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
3 Acidobacterium_capsulatum--ATCC_51196 1.000000 0.000000 0.999981 0.999990 0.999989 0.999987 0.999987 0.999990 0.999988 0.999988 0.999994 0.999989 1.000000 0.999988 0.999987 0.999987 0.999988 0.999989 0.999991 0.999987
4 Bacillus_subtilis--168 1.000000 0.999981 0.000000 0.999990 0.999989 0.999989 0.999989 0.999989 0.999988 0.999986 0.999995 0.999985 0.999999 0.999988 0.999987 0.999989 0.999988 0.999778 0.999993 0.999987
5 Escherichia_coli--CFT073 1.000000 0.999990 0.999990 0.000000 0.825741 0.807495 0.807218 0.991156 0.996855 0.997849 0.999996 0.999633 1.000000 0.993885 0.996736 0.994148 0.993821 0.999991 0.999984 0.999291
6 Escherichia_coli--EDL933 1.000000 0.999989 0.999989 0.825741 0.000000 0.735107 0.734775 0.996126 0.998058 0.997908 0.999997 0.999640 1.000000 0.993993 0.997126 0.994390 0.994059 0.999991 0.999986 0.999292
7 Escherichia_coli--K-12_MG1655 1.000000 0.999987 0.999989 0.807495 0.735107 0.000000 0.382567 0.996190 0.997747 0.997455 0.999996 0.999604 1.000000 0.993444 0.996645 0.993773 0.993431 0.999989 0.999984 0.999174
8 Escherichia_coli--K-12_W3110 1.000000 0.999987 0.999989 0.807218 0.734775 0.382567 0.000000 0.996220 0.997761 0.997467 0.999995 0.999604 1.000000 0.993445 0.996669 0.993769 0.993443 0.999990 0.999985 0.999165
9 Klebsiella_pneumoniae--ATCC_13883 1.000000 0.999990 0.999989 0.991156 0.996126 0.996190 0.996220 0.000000 0.845220 0.840545 0.999997 0.999648 1.000000 0.996177 0.998128 0.996268 0.996052 0.999990 0.999987 0.999325
10 Klebsiella_pneumoniae--HS11286 1.000000 0.999988 0.999988 0.996855 0.998058 0.997747 0.997761 0.845220 0.000000 0.906475 0.999996 0.999683 1.000000 0.997724 0.995697 0.997776 0.997769 0.999989 0.999979 0.999463
11 Klebsiella_pneumoniae--MGH_78578 1.000000 0.999988 0.999986 0.997849 0.997908 0.997455 0.997467 0.840545 0.906475 0.000000 0.999996 0.999704 1.000000 0.997928 0.995054 0.997844 0.997868 0.999990 0.999980 0.999479
12 Opitutus_terrae--PB90-1 1.000000 0.999994 0.999995 0.999996 0.999997 0.999996 0.999995 0.999997 0.999996 0.999996 0.000000 0.999997 0.999998 0.999996 0.999996 0.999996 0.999995 0.999997 0.999993 0.999996
13 Proteus_mirabilis--HI4320 1.000000 0.999989 0.999985 0.999633 0.999640 0.999604 0.999604 0.999648 0.999683 0.999704 0.999997 0.000000 1.000000 0.999604 0.999699 0.999622 0.999613 0.999987 0.999983 0.999505
14 Saccharolobus_islandicus--M.16.4 1.000000 1.000000 0.999999 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 0.999998 1.000000 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
15 Salmonella_enterica--AKU_12601 1.000000 0.999988 0.999988 0.993885 0.993993 0.993444 0.993445 0.996177 0.997724 0.997928 0.999996 0.999604 1.000000 0.000000 0.869238 0.682277 0.663383 0.999990 0.999985 0.999260
16 Salmonella_enterica--CT18 1.000000 0.999987 0.999987 0.996736 0.997126 0.996645 0.996669 0.998128 0.995697 0.995054 0.999996 0.999699 1.000000 0.869238 0.000000 0.890872 0.886148 0.999988 0.999976 0.999524
17 Salmonella_enterica--LT2 1.000000 0.999987 0.999989 0.994148 0.994390 0.993773 0.993769 0.996268 0.997776 0.997844 0.999996 0.999622 1.000000 0.682277 0.890872 0.000000 0.622606 0.999989 0.999985 0.999296
18 Salmonella_enterica--P125109 1.000000 0.999988 0.999988 0.993821 0.994059 0.993431 0.993443 0.996052 0.997769 0.997868 0.999995 0.999613 1.000000 0.663383 0.886148 0.622606 0.000000 0.999988 0.999983 0.999270
19 Shouchella_clausii--KSM-K16 1.000000 0.999989 0.999778 0.999991 0.999991 0.999989 0.999990 0.999990 0.999989 0.999990 0.999997 0.999987 1.000000 0.999990 0.999988 0.999989 0.999988 0.000000 0.999991 0.999988
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 1.000000 0.999991 0.999993 0.999984 0.999986 0.999984 0.999985 0.999987 0.999979 0.999980 0.999993 0.999983 1.000000 0.999985 0.999976 0.999985 0.999983 0.999991 0.000000 0.999983
21 Yersinia_ruckeri--YRB 1.000000 0.999987 0.999987 0.999291 0.999292 0.999174 0.999165 0.999325 0.999463 0.999479 0.999996 0.999505 1.000000 0.999260 0.999524 0.999296 0.999270 0.999988 0.999983 0.000000
+1
View File
@@ -0,0 +1 @@
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0 0 0 0 0 0 0 0 0 0 0 0 8 0 1 0 0 0 0 3
3 Acidobacterium_capsulatum--ATCC_51196 0 0 203 119 128 141 140 116 109 111 78 112 0 136 109 147 134 117 55 129
4 Bacillus_subtilis--168 0 203 0 124 132 128 123 133 109 130 66 158 6 131 112 124 135 2393 46 124
5 Escherichia_coli--CFT073 0 119 124 0 1966777 1998059 1999094 117743 32029 22312 63 4225 0 74946 31918 73311 76585 113 128 7854
6 Escherichia_coli--EDL933 0 128 132 1966777 0 2627885 2628700 52488 20134 22064 48 4202 0 74655 28602 71244 74665 112 108 7963
7 Escherichia_coli--K-12_MG1655 0 141 128 1998059 2627885 0 4452541 48302 21382 24602 47 4277 0 75729 30449 73622 76778 119 111 8566
8 Escherichia_coli--K-12_W3110 0 140 123 1999094 2628700 4452541 0 47894 21226 24470 68 4278 0 75658 30207 73614 76583 112 108 8660
9 Klebsiella_pneumoniae--ATCC_13883 0 116 133 117743 52488 48302 47894 0 1416091 1477759 42 4172 0 48296 18988 48144 50416 120 106 7712
10 Klebsiella_pneumoniae--HS11286 0 109 109 32029 20134 21382 21226 1416091 0 644063 42 2738 0 21498 29758 21606 21376 99 102 4417
11 Klebsiella_pneumoniae--MGH_78578 0 111 130 22312 22064 24602 24470 1477759 644063 0 42 2614 0 19948 35067 21330 20813 97 102 4374
12 Opitutus_terrae--PB90-1 0 78 66 63 48 47 68 42 42 42 0 43 18 57 42 53 66 39 58 43
13 Proteus_mirabilis--HI4320 0 112 158 4225 4202 4277 4278 4172 2738 2614 43 0 0 4254 2481 4166 4215 131 103 4704
14 Saccharolobus_islandicus--M.16.4 8 0 6 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0
15 Salmonella_enterica--AKU_12601 0 136 131 74946 74655 75729 75658 48296 21498 19948 57 4254 0 0 1047731 2857146 2951421 117 108 7643
16 Salmonella_enterica--CT18 1 109 112 31918 28602 30449 30207 18988 29758 35067 42 2481 0 1047731 0 917948 940297 106 106 3716
17 Salmonella_enterica--LT2 0 147 124 73311 71244 73622 73614 48144 21606 21330 53 4166 0 2857146 917948 0 3284800 122 108 7460
18 Salmonella_enterica--P125109 0 134 135 76585 74665 76778 76583 50416 21376 20813 66 4215 0 2951421 940297 3284800 0 134 124 7645
19 Shouchella_clausii--KSM-K16 0 117 2393 113 112 119 112 120 99 97 39 131 0 117 106 122 134 0 58 124
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 0 55 46 128 108 111 108 106 102 102 58 103 0 108 106 108 124 58 0 96
21 Yersinia_ruckeri--YRB 3 129 124 7854 7963 8566 8660 7712 4417 4374 43 4704 0 7643 3716 7460 7645 124 96 0
+181
View File
@@ -0,0 +1,181 @@
#!/usr/bin/env python3
"""Compare an obikmer count index against a reference kmer set (presence + counts).
Loads the reference .npz (sorted uint64 kmers + uint32 counts from build_reference.py),
streams `obikmer dump` from a --with-counts index, then reports:
- false negatives : kmers in reference absent from the index
- false positives : kmers in the index absent from the reference
- count mismatches: kmers present in both but with differing counts
Output to stdout: one CSV row
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index(obikmer_bin: str, index_dir: str) -> tuple[np.ndarray, np.ndarray]:
"""Stream `obikmer dump` and return (kmers_sorted_uint64, counts_uint32)."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers, counts = [], []
header = True
for line in proc.stdout:
if header:
header = False
continue
parts = line.rstrip('\n').split(',')
kmers.append(encode_kmer(parts[0]))
counts.append(int(parts[1]))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
order = np.argsort(np.array(kmers, dtype=np.uint64), kind='stable')
return (np.array(kmers, dtype=np.uint64)[order],
np.array(counts, dtype=np.uint32)[order])
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref_kmers: np.ndarray, ref_counts: np.ndarray,
idx_kmers: np.ndarray, idx_counts: np.ndarray,
) -> tuple[np.ndarray, np.ndarray, np.ndarray, np.ndarray, np.ndarray]:
"""Return (false_neg, false_pos, cm_ref_kmers, cm_ref_counts, cm_idx_counts).
All arrays sorted; cm_* cover kmers present in both arrays but with
differing counts.
"""
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers.
# Both arrays are sorted so we can use searchsorted.
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
shared_ref_counts = ref_counts[shared_mask]
shared_idx_counts = idx_counts[pos_in_idx[shared_mask]]
mismatch_mask = shared_ref_counts != shared_idx_counts
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref_counts = shared_ref_counts[mismatch_mask]
cm_idx_counts = shared_idx_counts[mismatch_mask]
return false_neg, false_pos, cm_kmers, cm_ref_counts, cm_idx_counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?',
help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='obikmer index directory (built with --with-counts)')
ap.add_argument('--obikmer', default='obikmer',
help='Path to obikmer binary')
ap.add_argument('--species', default='')
ap.add_argument('--strain', default='')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
ap.add_argument('--save-cm', metavar='FILE',
help='Save count-mismatch rows (kmer,ref_count,idx_count) to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
# Detect k
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers, idx_counts = load_index(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos, cm_kmers, cm_ref, cm_idx = compare(
ref_kmers, ref_counts, idx_kmers, idx_counts)
n_shared = len(ref_kmers) - len(false_neg)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f'false negatives : {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives : {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
print(f'count mismatches: {len(cm_kmers):,} ({cm_pct:.4f}% of shared)',
file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_cm and len(cm_kmers):
with open(args.save_cm, 'w') as fh:
fh.write('kmer,ref_count,idx_count\n')
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
fh.write(f'{decode_kmer(int(v), k)},{rc},{ic}\n')
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
if __name__ == '__main__':
main()
+201
View File
@@ -0,0 +1,201 @@
#!/usr/bin/env python3
"""Verify the merged count index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer+count pairs from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_count.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, tuple[list[int], list[int]]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order
per_specimen : mapping label → (kmer_ints, counts) for entries > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:]
per_specimen: dict[str, tuple[list[int], list[int]]] = {
name: ([], []) for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
count = int(parts[i + 1])
if count > 0:
per_specimen[name][0].append(kmer_int)
per_specimen[name][1].append(count)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
count_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
save_cm: Path | None,
) -> str:
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
npz = np.load(ref_path)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
order = np.argsort(np.array(kmer_list, dtype=np.uint64), kind='stable')
idx_kmers = np.array(kmer_list, dtype=np.uint64)[order]
idx_counts = np.array(count_list, dtype=np.uint32)[order]
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
mismatch_mask = ref_counts[shared_mask] != idx_counts[pos_in_idx[shared_mask]]
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref = ref_counts[shared_mask][mismatch_mask]
cm_idx = idx_counts[pos_in_idx[shared_mask]][mismatch_mask]
n_shared = int(shared_mask.sum())
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%) '
f'cm={len(cm_kmers):,} ({cm_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
if save_cm and len(cm_kmers):
cm_file = save_cm / f'{name}_cm.csv'
lines = ['kmer,ref_count,idx_count']
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
lines.append(f'{decode_kmer(int(v), k)},{rc},{ic}')
cm_file.write_text('\n'.join(lines) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged count index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory for false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory for false-positive kmer lists')
ap.add_argument('--save-cm', metavar='DIR',
help='Directory for count-mismatch CSV files')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
save_cm = Path(args.save_cm) if args.save_cm else None
for d in (save_fn, save_fp, save_cm):
if d: d.mkdir(parents=True, exist_ok=True)
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
kmers, counts = per_specimen[name]
row = compare_specimen(name, kmers, counts, ref_dir, k,
save_fn, save_fp, save_cm)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_count"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_count"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_count.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'count_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/count_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+170
View File
@@ -0,0 +1,170 @@
#!/usr/bin/env python3
"""Verify the merged presence index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer sets from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_presence.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, list[int]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order (excluding 'kmer')
per_specimen : mapping label → list of kmer ints where presence > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:] # first col is 'kmer'
per_specimen: dict[str, list[int]] = {name: [] for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
if int(parts[i + 1]) > 0:
per_specimen[name].append(kmer_int)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
) -> str:
"""Compare one specimen column against its reference .npz.
Returns a CSV row string.
"""
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
ref_kmers = np.load(ref_path)['kmers'] # sorted uint64
idx_kmers = np.array(sorted(kmer_list), dtype=np.uint64)
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged presence index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory to save false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory to save false-positive kmer lists')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
if save_fn: save_fn.mkdir(parents=True, exist_ok=True)
if save_fp: save_fp.mkdir(parents=True, exist_ok=True)
# Detect k
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
row = compare_specimen(name, per_specimen[name], ref_dir, k, save_fn, save_fp)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_presence"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_presence"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_presence.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'presence_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/presence_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_count.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying count"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_presence.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying presence"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+139
View File
@@ -0,0 +1,139 @@
#!/usr/bin/env python3
"""Compare an obikmer index against a reference kmer set (presence/absence).
Loads the reference .npz (sorted uint64 kmers built by build_reference.py),
streams the output of `obikmer dump`, encodes each kmer string to uint64,
then reports false negatives and false positives using numpy set operations.
Output to stdout: one CSV row
species, strain, ref_kmers, idx_kmers, false_neg, false_pos, fn_pct, fp_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index_kmers(obikmer_bin: str, index_dir: str) -> np.ndarray:
"""Stream `obikmer dump` and return a sorted uint64 array of kmer integers."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers = []
header = True
for line in proc.stdout:
if header:
header = False
continue
kmer_str = line.split(',', 1)[0]
kmers.append(encode_kmer(kmer_str))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
arr = np.array(kmers, dtype=np.uint64)
arr.sort()
return arr
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref: np.ndarray, idx: np.ndarray) -> tuple[np.ndarray, np.ndarray]:
"""Return (false_negatives, false_positives) as uint64 arrays."""
false_neg = np.setdiff1d(ref, idx, assume_unique=True)
false_pos = np.setdiff1d(idx, ref, assume_unique=True)
return false_neg, false_pos
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?', help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?', help='obikmer index directory')
ap.add_argument('--obikmer', default='obikmer', help='Path to obikmer binary')
ap.add_argument('--species', default='', help='Species label for CSV row')
ap.add_argument('--strain', default='', help='Strain label for CSV row')
ap.add_argument('--header', action='store_true', help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
# Detect k from the index (one cheap call before the full dump).
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # already sorted uint64
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers = load_index_kmers(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos = compare(ref_kmers, idx_kmers)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f'false negatives: {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives: {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False negatives saved → {args.save_fn}', file=sys.stderr)
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False positives saved → {args.save_fp}', file=sys.stderr)
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
if __name__ == '__main__':
main()
+323
View File
@@ -0,0 +1,323 @@
# NUMA-aware partition runner
## Problem
All partition-level parallel loops in obikindex currently fall into two
categories:
**Naive Rayon** — used in `build_layers`, `pack_matrices`, `dump`, `select`,
`stats`, `rebuild`, `reindex`:
```rust
(0..n).into_par_iter().for_each(|i| work(i));
```
Threads come from the global Rayon pool with no NUMA awareness. On
multi-socket machines this produces cross-socket memory traffic and degrades
performance super-linearly (see [NUMA-aware worker pools](numa_worker_pools.md)).
**Ad-hoc adaptive pool** — used in `merge`:
A bespoke implementation with pre-spawned workers, channel-based dispatch, and
activation control. It handles NUMA correctly but is not reusable.
Both cases should be replaced by a single generic mechanism.
## Unified model
The key insight is that **UMA is just the NUMA case with a single node**. The
runner always works the same way: one controller thread per node, each
independently managing its own workers with the same adaptive logic. The only
difference between UMA and NUMA is the number of nodes and whether workers are
pinned.
```
NUMA (k nodes) UMA (1 node)
controller-0 controller-1 … controller-0
│ │ │
workers[0] workers[1] workers[0]
(pinned) (pinned) (global pool)
└───────────────┴──────────────────┘
shared work queue
```
On each node, the Rayon `ThreadPool` is pinned to that node's CPUs.
`pool.install()` ensures all internal Rayon calls (inside the work function)
use the node-local pool. Linux first-touch then places heap allocations in
local DRAM automatically.
On UMA the global Rayon pool is used directly — no pinning, no overhead.
## Adaptive mechanism
Each controller follows the same logic regardless of node count:
1. Pre-spawn `workers_per_node` dormant worker threads (blocked on `activate_rx`).
2. Activate the first worker immediately.
3. Loop on result channel with a `SPAWN_POLL` timeout:
- On result: call `on_done`; check whether to activate the next worker.
- On timeout: same check.
- Activation criterion: `should_spawn_worker(active, global_efficiency, prev_efficiency)`.
4. Drop `activate_tx` when done — dormant workers exit cleanly.
**Global CPU efficiency** (`CpuSample`, reads `/proc/stat` on Linux) is used by
all controllers — no per-node measurement needed. The signal is coarser than
per-node efficiency but correct in practice: if any node saturates memory
bandwidth, the global efficiency drops and all controllers stop activating
workers. Using a standard portable primitive avoids platform-specific CPU
accounting and keeps the implementation clean.
## Proposed API
```rust
pub struct PartitionRunner {
// One entry per NUMA node; one entry total on UMA.
nodes: Vec<NodeConfig>,
}
struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>, // None = global Rayon pool (UMA)
cpu_ids: Vec<usize>, // empty = no pinning (UMA)
max_workers: usize,
}
impl PartitionRunner {
/// Detect topology and build the runner.
/// Returns a single-node runner on UMA / macOS / hwloc failure.
pub fn new() -> Self;
/// Run `f(i)` for every index in `order`, collecting results.
///
/// `on_done(i, result, elapsed)` is called under an internal mutex as
/// each partition completes — use it for progress bars and aggregation.
/// The runner serialises all calls to `on_done` via an internal
/// `Arc<Mutex<C>>`, so no `Sync` bound is required on the callback.
/// `Send` is required because the Arc clone crosses thread boundaries.
///
/// Serialisation is free in practice: a partition takes seconds to
/// minutes; the callback takes microseconds. Contention is negligible.
///
/// Returns the first error from `f`, if any.
pub fn run<F, R, E, C>(
&self,
order: &[usize],
f: F,
on_done: C,
) -> Result<(), E>
where
F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send,
E: Send,
C: FnMut(usize, R, Duration) + Send; // Send required, Sync is not
}
```
`order` is caller-supplied so each command chooses its scheduling strategy:
largest-first for `merge`, sequential for `build_layers`, etc.
## Migration examples
### merge.rs (before: ~180 lines of bespoke machinery)
```rust
let runner = PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
.map_err(OKIError::Partition),
|i, g_len, dur| {
pb.inc(1);
debug!("partition {i}: done in {:.1}s — {g_len} new kmers", dur.as_secs_f64());
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
},
)?;
```
### index.rs build_layers (before: naive into_par_iter)
```rust
let order: Vec<usize> = (0..n).collect();
let runner = PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits)
.map_err(OKIError::Partition),
|_, n_kmers, _| {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
pb.inc(1);
},
)?;
```
All other sites (`pack_matrices`, `dump`, `select`, etc.) follow the same
pattern.
## Placement
`PartitionRunner` lives in `obikindex/src/numa.rs` alongside `NumaSetup`.
It depends only on standard library primitives and Rayon — no new dependencies.
A single `PartitionRunner` instance can be built once per command invocation
and reused across multiple `run()` calls (e.g. `merge` runs
`merge_partitions` then `pack_matrices`).
## Known issue: CPU-only activation signal stalls on I/O-bound stages
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
the rest of the stage, even though 256 partitions keep completing over several
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
over-provisioning ... I/O-bound ... workloads") but conflates two different
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
still benefit from more concurrent workers even with flat CPU usage — a signal
the current mechanism cannot see.
A one-off artefact was also found in the same log: right after a stage
transition, `do_i_activate` produced a physically impossible spike (efficiency
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
too short to be meaningful, so a burst of rapid completions right after
activating a worker can divide a real CPU delta by a near-zero wall delta.
### Implemented: I/O signal + shared debounce guard
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
submitted to the block layer — not `rchar`/`wchar`, which also count
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
dependency — same pattern as the existing `getrusage` bindings). Any other
target degrades gracefully to a signal that never triggers (falls back to
CPU-only activation), same pattern as `cgroup_v2_available`.
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
headroom, making `PartitionRunner` adapt to whichever resource is actually the
bottleneck without per-call configuration. Both samplers are called
unconditionally — no `||` short-circuit — so neither window starves behind
whichever signal fires first:
```rust
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
if cpu_wants_more || io_wants_more {
activation.grow(GROWTH_DIVISOR, n_total);
}
```
The CPU threshold is *not* the flat absolute delta it started as: it scales
with `activation.last_step()` — the number of workers activated in the last
growth step, tracked by `NodeActivation` (`numa.rs`) and updated every time
`grow()` actually grows something. Growing by 8 workers should add ~8 cores of
efficiency if the workload is truly CPU-bound; requiring only
`CPU_SPAWN_THRESHOLD` (20 %) of that expected gain confirms the growth was
useful without demanding perfect linear scaling. Scaling by the *last step's
size* rather than the cumulative total keeps the bar equally meaningful
whether it's the 2nd growth step or the 20th — a flat absolute threshold
(0.2 core) is a strong signal at 8 active workers but pure noise at 150; a
threshold scaled by the *cumulative* total instead (considered and rejected)
would have made the bar essentially impossible to clear late in the ramp,
strangling exactly the CPU-bound saturation the mechanism exists to allow.
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
**relative** growth threshold instead of an absolute one:
```rust
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
self.bytes = n;
self.wall = Instant::now(); // reset only on a real sample
activate
}
```
The `elapsed < 0.1s → return false without mutating state` guard was also
back-ported into `CpuSample::do_i_activate` (previously missing — source of
the ~94-core artefact above) — one fix for both problems, and it removes the
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
outright rather than papered over with a hardware-dependent constant.
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, module-level
`const` in `numa.rs`, both `0.2`) are a starting point, not a derived value:
`0.2` (20 % relative growth) for `IoSample` was chosen to match the CPU
threshold's *implicit* relative sensitivity (in the observed log, an 8→9
worker step raised efficiency by ~12 %) — but I/O throughput is lumpier than
CPU time (buffered writes flush in bursts), so it needs empirical validation
against a real `pack` run before being considered final.
## Known issue: ramp-up too slow, and confused with node count
The original design started `n_nodes` workers (one per node) and grew one
worker at a time. On a real `filter` run this took ~10 minutes to climb from
9 to ~40 active workers even on the CPU-bound `rebuild` stage — most of a
35-minute stage spent under-provisioned while waiting for evidence to
accumulate one worker at a time. There is no scale-down mechanism (`n_active`
only grows), so the original caution was deliberate — but a quarter of
available cores is still far from saturation, and the real risk zone (over-provisioning
a memory-bandwidth-bound stage) only shows up much later in the ramp, near
full occupancy — not at 25 %.
The fix decouples ramp speed from node *count*: both the initial size and the
growth step are a fraction of `workers_per_node` (node *size*), applied
identically on every node. A single-NUMA-node (UMA) machine ramps exactly as
fast as an 8-node one — growing by `n_nodes` per step, as first considered,
would have degenerated to "grow by 1" on UMA, reproducing the original
problem for exactly the machines that need the fix most.
```rust
// NodeActivation::grow — called both at startup (activate_initial) and on
// every CPU/IO-triggered growth step, with a different divisor each time.
let wanted = (self.caps[idx] / divisor).max(1); // INITIAL_DIVISOR=4 at startup, GROWTH_DIVISOR=8 per step
let room = self.caps[idx].saturating_sub(self.active[idx]);
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
```
This also fixed a latent correctness gap: the original single shared
`activate_tx`/`activate_rx` pair had *no* per-node addressing — sending one
activation signal woke up whichever dormant worker (from any node) happened
to win the race on that channel. `crossbeam_channel` gives no fairness
guarantee across competing receivers, so "round-robin across nodes" was an
assumption the code never actually enforced. `PartitionRunner::run` now opens
one activation channel per node (`activate_txs`/`activate_rxs`, one pair per
`NodeConfig`); `NodeActivation` (`numa.rs`) tracks how many of each node's
dormant workers have been woken and grows every node by the same amount per
step, capped by that node's remaining dormant workers and by the run's total
budget (`n_total`) — balance across nodes is now guaranteed by construction,
not incidental to channel implementation details.
## Open questions
- **Error handling**: `run` currently returns the first error; remaining errors
are dropped. A `Vec<E>` return would give complete diagnostics.
- **`INITIAL_DIVISOR` / `GROWTH_DIVISOR` tuning**: currently `4` and `8`
(start at 1/4 of a node's cores, grow by 1/8 per step), chosen to fix an
observed too-slow ramp — not yet validated against a real `pack` (I/O-bound)
run, where over-provisioning risk is different from the CPU-bound `rebuild`
case this was tuned against.
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
boundaries); `Sync` is not (only one thread holds the lock at a time).
Contention is negligible because a partition takes seconds while the callback
takes microseconds. The callback is therefore simple to write (plain
`Vec::push`, plain `FnMut`) with no measurable performance cost.
+97
View File
@@ -0,0 +1,97 @@
# NUMA-aware worker pools for merge
## Problem
The merge command's bottleneck is `compute_degrees` in `obidebruinj`: a random pointer-chase over 20–70 M node hash maps that saturates DRAM bandwidth. When multiple partition workers run concurrently, they contend for the shared memory bus, causing super-linear slowdown (measured: 0.016 µs/node solo → 0.95 µs/node with 4–5 concurrent workers, ×60 degradation).
Modern HPC nodes are multi-socket NUMA machines (observed: 2 sockets × 4 NUMA nodes × 24 cores = 192 cores). Cross-NUMA memory traffic compounds the contention:
- Full 192-core run: ~15 min/partition (×10 worse than M3 Mac)
- `taskset` restricted to 4 NUMA nodes (96 cores): ~90 s/partition
- OAR job on 1 NUMA node (24 cores): ~80 s/partition, same throughput as 96 cores
**Conclusion**: the bottleneck is memory bandwidth per NUMA node, not core count. 24 cores on one NUMA node achieve the same throughput as 96 cores across four.
## Strategy
Run N worker groups in parallel, one per NUMA node, each with its own Rayon thread pool whose threads are pinned to the NUMA node's CPUs. Linux's first-touch policy then places graph allocations on local DRAM automatically — no explicit NUMA allocator needed.
Expected throughput: N × single-NUMA throughput. On the 8-NUMA-node HPC: 8 × ~80 s = 9–10 min total instead of >60 min with the current single-pool approach.
## Rayon thread pool isolation
Rayon provides `ThreadPool::install(|| { ... })`: any Rayon call (`par_iter`, `current_num_threads`, etc.) inside the closure uses *that* pool exclusively. Wrapping `merge_partition` in `pool.install()` redirects all downstream Rayon calls — including those in `debruijn.rs` and `partition.rs` — without touching those crates.
```rust
// worker thread, assigned to NUMA pool `pool`
pool.install(|| {
dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
})
```
`rayon::current_num_threads()` inside `merge_partition` will return the pool size (e.g. 24), not the global thread count — which is the right value for buffer sizing.
## Thread pinning
`ThreadPoolBuilder::spawn_handler` provides a hook executed for each thread at creation. Inside, `libc::sched_setaffinity` pins the thread to a CPU set:
```rust
let cpus: Vec<usize> = numa_node_cpus(node); // from /sys/devices/system/node/nodeN/cpulist
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let mut b = std::thread::Builder::new();
std::thread::Builder::new().spawn(move || {
pin_to_cpus(&cpus); // sched_setaffinity via libc
thread.run()
})?;
Ok(())
})
.build()?
```
NUMA topology is read from `/sys/devices/system/node/node*/cpulist` — no `libnuma` dependency required. If the `numa` crate is linked, `numa_available()` / `numa_run_on_node()` are an alternative.
## Memory locality
Linux allocates pages on the NUMA node of the thread that first writes them (first-touch policy). Once Rayon threads are pinned to node N, all graph data built by those threads lands on node N's DRAM. No changes to the allocator, no explicit `numa_alloc_onnode` calls.
## Adaptive spawn criterion
The current criterion uses `std::thread::available_parallelism()` (returns total cores = 192) and `max_workers = n_cores / 2`. With NUMA pools:
- `n_cores` per pool = cores per NUMA node (e.g. 24)
- `max_workers` per pool = pool size / 2 (e.g. 12)
- CPU efficiency is measured per pool, not globally
Each NUMA group runs its own independent adaptive pool. Workers are distributed across NUMA groups round-robin or by workload (partition assignment can be pre-split by NUMA group index).
## Required changes
| File | Change |
|------|--------|
| `obikindex/src/merge.rs` | Detect NUMA topology; build N `ThreadPool`s with pinned threads; assign each pre-spawned worker to a pool; wrap `merge_partition` in `pool.install()` |
| `obikindex/src/merge.rs` | Replace `available_parallelism()` with per-NUMA core count for spawn criterion |
| `obikpartitionner/src/merge_layer.rs` | No change — `merge_partition` already works inside any Rayon context |
| `obidebruinj/src/debruijn.rs` | No change — `par_iter` and `current_num_threads` are pool-context-aware |
| `obikpartitionner/src/partition.rs` | No change — same reason |
## Platform guard
NUMA pinning is Linux-only. The fallback is the current single global pool:
```rust
#[cfg(target_os = "linux")]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { ... }
#[cfg(not(target_os = "linux"))]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { None }
```
When `build_numa_pools()` returns `None` (macOS, UMA, or single-socket), `merge.rs` uses the existing code path unchanged.
## Open questions
- **Partition assignment**: split partitions by NUMA group up-front (static) or use a shared queue with per-group workers stealing from a common pool? Static split is simpler; stealing is better for load balance when partitions vary widely in size.
- **Intra-NUMA adaptive criterion**: with 24 cores and ~3–5 effective workers per NUMA node, the current marginal-gain criterion needs re-tuning or can be left as-is with per-pool `n_cores = 24`.
- **I/O**: partition data (unitig files) is on a shared filesystem. With 8 concurrent NUMA groups, I/O concurrency increases 8× — need to verify the filesystem (Lustre or local SSD) can absorb it without becoming the new bottleneck.
+255 -38
View File
@@ -16,27 +16,43 @@ Given a set of query sequences, determine for each sequence how many of its k-me
## Algorithm
The query follows the same superkmer-based partitioning strategy used at indexing time.
The query follows the same superkmer-based partitioning strategy used at indexing time. Everything below happens inside `process_chunk` (`query.rs`); there is no separate per-stage function, but the internal data flow is staged: k-mer-level dereplication, a two-part MPHF/column-major matrix lookup (`obikpartitionner::query_partition_with`), and a sparse Findere pass, each producing sparse intermediate structures rather than one dense allocation for the whole chunk.
```
for each chunk of sequences (parallel workers via obipipeline):
build QueryBatch: decompose all sequences into s-mers via superkmers, deduplicate
allocate seq_results[seq_idx][smer_pos] = None ← per-sequence s-mer result vectors
split superkmers by partition via minimiser hash
for each chunk of sequences (parallel workers via obipipeline, one call to process_chunk):
build QueryBatch (QueryBatch::from_records):
decompose all sequences into superkmers (SuperKmerIter) — construction only,
not the dedup key
deduplicate at k-mer granularity, split by partition in the same pass:
by_partition: Vec<HashMap<CanonicalKmer, Vec<KmerDesc>>> ← KmerDesc = (seq_idx, pos)
allocate SmerIndex (SmerIndex::new): in_index: Vec<bool>, sized total_smers —
NOT multiplied by n_genomes
allocate by_genome: Vec<Vec<(seq_idx, pos, value)>>, one empty Vec per genome —
stays empty (zero cost) for every genome this chunk never matches
for each partition p:
query_partition(p, superkmers_routed_to_p)
→ load QueryLayer(s) for p
→ for each s-mer in each superkmer: MphfLayer::find(smer)
fill seq_results[seq_idx][kmer_offset + j] from partition results
for each sequence:
apply_findere(seq_results[seq_idx], effective_z) ← per full sequence
accumulate confirmed k-mer results into acc and cov
emit annotated sequences
query_partition_with(p, kmers_for_p, on_event):
stage 1 (MPHF-only): for each unique k-mer, try each layer's MphfLayer::find
in turn, stop at the first hit; bucket confirmed hits by (layer, slot);
emit QueryHit::Found(descs) once per hit k-mer
stage 2 (column-major fetch): for each layer with ≥1 hit, for each genome
column g in 0..layer.n_cols(): scan that layer's bucketed slots, look up
col_value(g, slot); emit QueryHit::Value(descs, g, value) on nonzero
on_event dispatches: Found → SmerIndex::mark_found for every desc;
Value → push (seq_idx, pos, value) into by_genome[g]
for each genome g with ≥1 hit (sparse_findere_for_genome):
sort by_genome[g] by (seq_idx, pos); detect maximal runs of consecutive pos
within one seq_idx; monotone-deque window-minimum scoped to each run →
confirmed_by_genome[g]: Vec<(seq_idx, pos_out, value)>
accumulate genome_totals per sequence from confirmed_by_genome (per genome, direct)
accumulate kmer_count / kmer_missing per (sequence, output position), O(1) each,
using only the confirmed-any bitmap and SmerIndex — independent of n_genomes
if --detail: densify confirmed_by_genome into per-(seq, genome) coverage arrays
emit annotated sequences (emit_batch)
```
Superkmers that appear more than once in the batch (same sequence or across sequences) are deduplicated: each unique `RoutableSuperKmer` is queried once per partition, and the result is broadcast to every `SKDesc` entry that references it.
Superkmers that appear more than once in the batch (same sequence or across sequences), or different superkmers that happen to share a k-mer (read overlaps, repeats, a SNP splitting an otherwise-identical run), are deduplicated at k-mer granularity: each unique `CanonicalKmer` triggers at most one MPHF lookup and, on hit, one matrix fetch, broadcast to every `KmerDesc` occurrence referencing it.
**Findere requires full-sequence aggregation.** `apply_findere` is applied once per sequence on the complete s-mer result vector, after all partitions have contributed. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers.
**Findere requires full-sequence aggregation.** The sliding window (now per-run, not per-sequence — see [Findere z-window filter](#findere-z-window-filter)) only ever runs after all partitions have contributed their hits to `by_genome`. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers.
Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads.
@@ -44,25 +60,46 @@ Batches are processed in parallel via `obipipeline` workers; the `--threads` fla
## Findere z-window filter
For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`. At query time, `set_k(s)` is in effect, so queries naturally produce s-mer results. `apply_findere` then aggregates z consecutive s-mer results into one k_user-mer answer:
For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`; `idx.kmer_size()` (bound to `k` in `process_chunk`) is this physically-indexed s-mer size, so decomposing the query at `k` naturally produces s-mer results.
```rust
fn apply_findere(
results: &[Option<Box<[u32]>>], // N s-mer results
z: usize,
n_genomes: usize,
) -> Vec<Option<Box<[u32]>>> // N − z + 1 k_user-mer results
The z-window aggregation is **sparse**, per genome, implemented in `sparse_findere_for_genome` (`query.rs`) — a run-detection pass followed by a monotone-deque sliding-window minimum scoped to each run, not a dense scan over every s-mer position of every sequence:
```
sparse_findere_for_genome(hits, z, presence, threshold):
// hits: raw (seq_idx, pos_smer, value) triples for this genome, as delivered
// by query_partition_with's QueryHit::Value — only ever nonzero entries;
// a position with no hit for this genome simply has no entry at all.
sort hits by (seq_idx, pos_smer)
for each maximal run of consecutive pos_smer values within the same seq_idx:
dq: VecDeque<(run-relative index, value)>
for k, (_, pos, value) in enumerate(run):
maintain dq monotone non-decreasing (pop back while back.value >= value)
push (k, value)
evict dq entries with run-relative index <= k - z
if k + 1 >= z:
win_min = dq.front().value
if win_min > 0:
pos_out = pos + 1 - z
confirmed.push((seq_idx, pos_out, adjust(win_min)))
return confirmed
```
Input length N (s-mers), output length N − z + 1 (k_user-mers).
A window can only be confirmed (`win_min > 0`) when all `z` s-mers in it are present *and* nonzero for this genome — which, by construction, can only happen strictly inside one contiguous run of hits (any gap — an absent or zero-valued s-mer — forces `win_min = 0` for every window spanning it, exactly matching the old dense scan's "not in index counts as 0" rule, just never materialising the zero). The deque logic is otherwise identical to the pre-sparsification version; it's scoped to run-relative indices instead of the whole sequence.
For each genome g independently, a sliding window of size z scans the input. Output position i is confirmed for genome g iff all z values `results[i..i+z][g]` are nonzero (`None` counts as zero for all genomes). The scan is O(n) per genome.
This runs once per genome that has at least one hit in the chunk (`process_chunk` iterates `by_genome`, one `Vec<(seq_idx, pos_smer, value)>` per genome, built from `QueryHit::Value` during the partition loop — genomes with zero hits in this chunk have an empty `Vec` and cost nothing beyond the iteration itself). Total work is `O(hits log hits)` per genome (the sort) rather than `O(n_smers)` per genome regardless of hit count — a genuine complexity win on top of the memory one, for the common case where most `(chunk, genome)` pairs have no or few hits.
Output values come from `results[i]` (leftmost s-mer of each window); genomes not confirmed are zeroed. If all genomes are zero, the position is returned as `None`.
Output position `pos_out` is confirmed for genome `g` iff its run produced a nonzero `win_min` — equivalent to "all `z` consecutive s-mer values in the window are nonzero for `g`", same semantics as before.
**Short sequences**: when the s-mer count is less than z, no complete window can form — `apply_findere` returns an empty vector. K-mers from sequences shorter than k_user are not emitted.
**The value reported per confirmed position is the window minimum, not the leftmost s-mer's raw value** — unchanged from the dense version. For presence indexes (0/1 values) this is equivalent to a logical AND either way. For count indexes it is not: the accumulated count for genome `g` at position `pos_out` is the minimum across the window, the weakest link — not the leftmost s-mer's own count. The presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw `win_min`) is applied once, inside `sparse_findere_for_genome`, rather than later during accumulation.
**Exact indexes**: `z = 1`, `apply_findere` is a passthrough (output length = input length).
**`kmer_missing` bookkeeping is independent of the per-genome sparse structures**, by design (see roadmap point 9): a lightweight dense `SmerIndex` (`in_index: Vec<bool>`, sized `total_smers` — **not** multiplied by `n_genomes`) is populated from `QueryHit::Found` during the partition loop, one entry per hit k-mer regardless of which genome(s) it matched. A position with no genome confirmed counts as `kmer_missing` iff the leftmost s-mer of that window is absent from `SmerIndex` entirely (see [`kmer_missing` semantics](#kmer_missing-semantics)).
**Coverage (`--detail`)** is built by re-scanning each genome's confirmed-hit list (already computed, no extra pass over raw data) and densifying into the `[u32; n_kmers_out]` arrays the JSON output format requires — but only when `--detail` is actually requested; the sparse structures cost nothing extra when it isn't.
**Short sequences**: when a sequence's s-mer count is less than `z`, its run(s) — if any hits exist at all — can never reach length `z`, so no window is ever confirmed for it; no k_user-mer is emitted, same outcome as the dense version's `n_kmers_out == 0` early-skip, reached here as a natural consequence rather than a separate check.
**Exact indexes**: `z = 1`, every single-hit "run" of length 1 immediately satisfies `k + 1 >= z`, so every hit is its own confirmed window with `win_min` equal to its own value — a passthrough, as before.
### Effective z at query time
@@ -85,14 +122,17 @@ The `-z` CLI option overrides the index metadata value. A higher z increases str
### `QueryLayer` variant selection
`QueryLayer::open` in `query_layer.rs` selects the data matrix to pair with `MphfLayer`:
`QueryLayer::open` (`obikpartitionner/src/query_layer.rs:28-45`) only ever returns two variants — `Presence` or `Count`, checked in this order:
| Condition | Variant | Data returned per k-mer |
|---|---|---|
| `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| `presence/` exists | `Presence` | 0/1 per genome (bit matrix) |
| only `counts/` exists | `Count` | counts used as-is |
| neither exists | `SetOnly` | 1 for every genome |
| Order | Condition | Variant | Data returned per k-mer |
|---|---|---|---|
| 1 | `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| 2 | (else) `presence/` exists, or `counts/` doesn't exist at all | `Presence` | see below |
| 3 | (else — `counts/` exists, `presence/` doesn't, `with_counts=false`) | `Count` | counts used as-is |
There is no `QueryLayer::SetOnly` variant. The "no on-disk matrix at all" case is handled one level down: `Presence` wraps `PersistentBitMatrix`, whose own `open()` (`obicompactvec/src/bitmatrix.rs:260-288`) auto-detects among **three** internal representations — `Packed` (`presence/matrix.pbmx`), `Columnar` (`presence/meta.json`), or `Implicit { n_rows, n_cols }` when neither file exists (built from `layer_meta.json`, `fill_row` returning all-`1`s without touching disk). This is where "1 for every genome" actually happens — not at the `QueryLayer` level.
**Worth double-checking, not confirmed as a bug**: `PersistentBitMatrix::open`'s `Implicit` branch constructs `Implicit { n_rows: meta.n, n_cols: 1 }` — `n_cols` is hardcoded to `1`, not to the layer's actual `n_genomes`. `fill_row` for `Implicit` only writes `buf[..1]`, leaving the rest of a longer `n_genomes`-sized buffer untouched (zeroed by the caller beforehand). If this path is ever reached for a layer covering more than one genome, only genome index 0 would read as present. Whether that's reachable in practice (layers might always be single-genome when they fall back to `Implicit`) wasn't verified here — flagging for follow-up, not fixing.
---
@@ -123,7 +163,7 @@ Coverage reflects confirmed k_user-mers only. The vectors are emitted in the JSO
## `kmer_missing` semantics
`kmer_missing` counts k_user-mer positions where the first s-mer (`seq_results[seq_idx][pos]`) is `None` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero are not counted as missing (the first s-mer being present is used as proxy for index membership).
`kmer_missing` counts k_user-mer positions where the leftmost s-mer of the window (`smer_index.is_in_index(seq_idx, pos)`, `SmerIndex`) is `false` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero (but the leftmost one is present) are not counted as missing — the leftmost s-mer being present is used as proxy for index membership.
---
@@ -152,8 +192,8 @@ Genome keys follow the iteration order of `meta.genomes`.
| Key | Type | Condition | Semantics |
|---|---|---|---|
| `kmer_count` | int | always | k-mers confirmed (post-Findere) with at least one genome match |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (pre-Findere None) |
| `kmer_strict_matches` | object | always | per-genome accumulated value (label → count or 0/1) |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (leftmost s-mer of the window not found) |
| `kmer_strict_matches` | object | always | per-genome accumulated value, non-zero entries only (label → count or 0/1) |
| `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) |
`kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index.
@@ -165,7 +205,7 @@ Genome keys follow the iteration order of `meta.genomes`.
```
obikmer query <index> [--detail] [--mismatch] [--count-missing]
[--force-presence] [--presence-threshold <n>]
[-z <z>] [-T <threads>]
[-z <z>] [-T <threads>] [--chunk-size <MiB>]
<query.fa> [<query2.fa> ...]
```
@@ -177,6 +217,7 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
| `--force-presence` | off | Report 0/1 per genome regardless of index counts |
| `--presence-threshold` | 1 | Minimum count to declare genome present |
| `-T` / `--threads` | all CPUs | Worker threads |
| `--chunk-size` | auto (from available RAM and thread count) | I/O chunk size in MiB — see [Future work, point 3](#throughput--parallelism--identified-potential-not-yet-implemented) for why the auto-sizing formula currently under-estimates memory on indexes with many genomes |
`--mismatch` is accepted but currently ignored with a warning on stderr.
@@ -187,3 +228,179 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
- **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently.
- **Read classification** (`--classify`): assign each read to the genome with the highest match score.
- **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores.
### Throughput & parallelism — identified potential (not yet implemented)
Observed on a 192-core (8×24 NUMA) machine: `query` uses ~10 cores or fewer, and the default chunk size gets the process OOM-killed. Root causes and candidate fixes, in dependency order:
**1. Single-threaded I/O source (main core-utilization bottleneck).**
`run()` builds `all_chunks` via `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` and passes it directly as the `input` iterator to `pipe.apply()`. In `obipipeline::Pipe::apply` (`scheduler.rs`), `input.next()` is called exclusively from the dedicated source thread — so file opening, decompression, and FASTA/FASTQ chunk-boundary parsing for *all* input files run serially in one thread, regardless of `--threads`. Compare with `steps::scatter` (used by `index`) and `cmd/superkmer.rs`: there, file opening + streaming is itself a `Flat` pipeline stage (`||?`), executed across the `n_workers` pool, with `obipipeline::throttle(paths, max_open)` bounding concurrently-open files in the source thread. That pattern parallelises I/O across files (and NUMA nodes); `query.rs` cannot.
Fix direction: restructure `query`'s pipe with an initial `Flat` stage analogous to `scatter`'s, opening/chunking files across workers instead of in `flat_map`.
**2. Gzip decompression is inherently single-threaded per file.**
`niffler`/`flate2` (used by `xopen`) do standard DEFLATE, which has no parallel-decodable structure for an arbitrary stream. Fix (1) parallelises *across* files but not *within* one large gzip file. Parking a possible fix (`rapidgzip-rs`) is tracked in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen).
**3. Chunk-size memory formula ignores `n_genomes`.**
`chunk_bytes = available_memory_bytes() / (n_workers * 16)` (`query.rs:407-414`) assumes a fixed ~8–16× overhead per raw input byte. But `KmerResults::new` (`query.rs:165-179`) allocates `data: Vec<u32>` sized `total_kmers_in_chunk × n_genomes` — dense, **for every k-mer position in the chunk, hit or not** — plus `win_min` and (with `--detail`) `cov`, same scaling. Real per-chunk memory is `O(n_genomes)`, not constant; the formula doesn't know `n_genomes` at all. This is the direct cause of the OOM kill on indexes with many reference genomes.
**4. MPHF lookup and matrix-row fetch are fused, not staged.**
`QueryLayer::find_into` (`obikpartitionner/src/query_layer.rs:48-67`) does the MPHF `find` *and* the `fill_row` matrix read in one call per k-mer, inside a single-threaded loop (`query_partition_with`). There is no separation between "is this k-mer indexed" (cheap, `O(1)`, independent of `n_genomes`) and "what are its per-genome values" (the expensive, `n_genomes`-scaling part).
**5. Dereplication should happen at k-mer granularity, directly — not via an intermediate superkmer-level dedup.**
`QueryBatch::from_records` currently dereplicates at the *superkmer* level (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, `query.rs:112`). This misses redundancy between k-mers shared by *different* superkmers (read overlaps, repeats, a SNP splitting an otherwise-identical run). Superkmer *construction* (`SuperKmerIter`) stays mandatory — it is the mechanism that computes minimizers/partition routing, not an optional dedup layer — but the dedup structure built on top of it should key directly on `CanonicalKmer`, in the same pass: `HashMap<CanonicalKmer, Vec<(seq_idx, pos)>>`. This also means the MPHF `find` itself runs once per **distinct** k-mer instead of once per occurrence — a win independent of the matrix-fetch cost below.
**6. Stage 1 output: bucket confirmed hits by layer, keyed by MPHF slot.**
For each unique canonical k-mer, MPHF lookup across a partition's layers stops at the first match (`query_partition_with:105-111`) — a k-mer belongs to at most one layer. So stage 1's output can be reshaped directly into:
```
HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>
```
replacing the `CanonicalKmer` key by the resolved `slot` (compact integer, and exactly what stage 2 needs to address the matrix). K-mers matching no layer simply have no entry here (they still count toward `in_index`/`kmer_missing` bookkeeping, which stays `O(1)` per position, independent of `n_genomes`).
**7. Partition-level parallelism is currently absent — and a NUMA-aware mechanism for exactly this already exists, unused, in `obikindex`.**
`process_chunk`'s partition loop (`query.rs:250-278`, `for (part_idx, part_sks) in by_part.iter().enumerate()`) processes every partition of a chunk sequentially on the single worker thread that owns that chunk. This is a parallelism axis on its own, independent of the column question below.
More importantly: `docmd/architecture/numa_partition_runner.md` and `numa_worker_pools.md` document `PartitionRunner` (`obikindex/src/numa.rs`), **already implemented** and already used by `merge.rs`, `index.rs` (`build_layers`), `select.rs`, `reindex.rs`, `rebuild.rs` — one controller thread per NUMA node, a Rayon pool pinned to that node's CPUs (`hwlocality`, `numa` feature, default-on in `obikindex/Cargo.toml`), adaptive worker activation driven by *both* a CPU-efficiency signal and an I/O-throughput signal (`CpuSample`/`IoSample`, `/proc/self/io` on Linux). It exists precisely because a naive `into_par_iter()` on the global Rayon pool measurably degrades ×60 on this codebase's own 192-core/8-NUMA reference machine (`numa_worker_pools.md`, § Problem) once workers contend for cross-socket memory bandwidth on shared mmap'd/hashed structures — exactly the shape of the matrix-column scan in point 8 below.
`obikmer` already depends on `obikindex` (`obikmer/Cargo.toml`, for `KmerIndex`), so `PartitionRunner` is directly reachable from `cmd/query.rs` — no new dependency. Both the partition-level loop and (see point 8) the genome-column scan should be driven through it rather than through ad-hoc `rayon::into_par_iter()`, to avoid reproducing the already-measured-and-fixed contention problem. Also relevant: the "CPU-only signal stalls on I/O-bound stages" issue documented for `pack_matrices` (mmap-heavy, page-fault-bound) applies just as much to a column-major mmap scan over persistent matrices — reuse the existing dual CPU/IO activation signal rather than re-deriving one.
>
> **Correction from implementation (Phase 4 below)**: this turned out not to be viable as described. `PartitionRunner::run()`'s actual body spawns roughly one OS thread per worker slot across every NUMA node **on every call** (confirmed by reading `numa.rs`, not just its doc comments) — fine for the one-call-per-command-invocation batch usage in `merge`/`build_layers`, but `query_partition_with` runs once per `(chunk, partition)`, far too frequently to absorb that spawn cost. Partition-level parallelism via `PartitionRunner` is deferred, not implemented. See Phase 4's "What did not ship, and why" for the detail.
**8. Stage 2: column-major matrix fetch, parallel across genome columns — via `PartitionRunner`, not naive `rayon`.**
Both persistent matrix formats are column-oriented on disk: `ColumnarCompactIntMatrix`/`ColumnarBitMatrix` (`obicompactvec/src/{intmatrix,bitmatrix}.rs`) mmap one file per genome column; `PackedCompactIntMatrix`/`PackedBitMatrix` mmap one region-offset per column in a single file. `fill_row(slot, buf)` as used today (`query.rs:262-272` via `on_hit`) reads **one slot across all `n_genomes` columns** per hit — the worst possible access pattern for this layout (up to `n_genomes` scattered mmap regions touched per single k-mer).
Better: for each layer, walk the matrix **column by column** (genome by genome): for each genome, scan the `slot` keys collected in step 6 for that layer and call `col.get(slot)`, keeping only nonzero results, and broadcast to the associated `(seq_idx, pos)` list. Total `get()` calls are unchanged (`n_hits × n_genomes` in the worst case) — the win is locality (sequential access within one mmap'd column at a time, not scattered across all columns per hit), not fewer operations.
Columns are independent (read-only, disjoint mmap regions) → embarrassingly parallel across genomes, *but* — per point 7 — `obicompactvec`'s existing `into_par_iter()` over `0..n_cols` (`sum()`, `count_nonzero()`, pairwise distance matrices) is the **naive, unpinned** pattern the rest of the codebase is actively migrating away from, not a model to copy here. Route this through `PartitionRunner` (or the same NUMA-pool machinery) instead. Two things to settle when this is designed: how the partition axis (point 7), the column axis, and the existing chunk-level `n_workers` `obipipeline` pool compose without oversubscribing the machine (three different concurrency mechanisms — raw-thread pipe workers, `PartitionRunner`'s pinned Rayon pools, and whatever drives the column scan — need a single reconciled thread budget, not three independent ones); and the threshold below which per-column dispatch overhead outweighs the gain (small `n_genomes` or small per-layer hit counts) — to be measured, not assumed.
>
> **Correction from implementation (Phase 4 below)**: column-major fetch is implemented — but as a plain sequential loop, not parallelised via `PartitionRunner`. Same reason as point 7's correction above. The column-major *locality* win (the actual claim of this point) does not depend on adding parallelism on top of it, and is validated independently. Column-level parallelism is deferred pending a mechanism that fits this call frequency (candidates noted in Phase 4).
**9. Sparse per-genome representation, fed directly to Findere.**
Stage 2's output should be `HashMap<genome_idx, Vec<(seq_idx, position, count)>>`, **sorted by `(seq_idx, position)`** once collected, instead of a dense `KmerResults`-style matrix — the key must carry `seq_idx`, not just `genome_idx`, because a chunk batches many sequences and `position` is only meaningful within one; a plain `Vec<(position, count)>` per genome would silently mix positions from different sequences and corrupt the sliding-window scan. This bounds retained memory by actual nonzero hits on both axes (position sparsity from non-matching k-mers, genome sparsity from a matched k-mer typically belonging to only a handful of genomes out of possibly many). The Findere sliding-window (`process_chunk`, the `win_min`/deque loop) would need reworking to run per `(sequence, genome)` over its sparse, sorted `(position, count)` list — detect runs of ≥`z` consecutive positions, window-min within each run — instead of today's dense `O(total_kmers × n_genomes)` scan. This is also a genuine complexity win (`O(hits log hits)` per genome vs. dense scan), not just memory.
**Not covered by this sparsification**: `--detail`'s `cov` accumulator (`query.rs:304-308`) has the identical `n_genomes`-dense scaling problem and wasn't folded into points above. It doesn't need to be retained densely throughout processing, though — only the final JSON serialization (`emit_batch`) requires a dense `[u32]` per `(seq, genome)`, and only for the sequences actually being output with `--detail`. Densification can stay a late, output-time-only step, reconstructed from the sparse per-genome lists.
**Secondary patterns available from `scatter.rs`/`superkmer.rs`, not yet in `query.rs`:**
- `throttle()` + `CommonArgs::effective_max_open()` to bound concurrently-open input files (query.rs defines its own `QueryArgs`, doesn't reuse this).
- Progress bar with EMA throughput + live active-worker gauges (`obisys::spinner`, `flat_active`/`transform_active` counters) — diagnostic value for locating the bottleneck.
- `obisys::Reporter`/`Stage::start`/`stop` timing per phase (used by `index`, `filter`; absent from `query`).
None of this is implemented yet — parked here as a coherent roadmap while the design is discussed further. Suggested dependency order: (1) I/O parallelism → (3) genome-aware chunk sizing → (4)–(9) staged/k-mer-deduped/NUMA-aware-partition-and-column-major/sparse query engine (larger refactor, biggest structural payoff — reuses `PartitionRunner` rather than inventing a new parallelism mechanism) → (2) parallel gzip (separate, orthogonal, tracked in chunkreader.md) → secondary diagnostics patterns.
---
## Implementation plan
Concrete, phased translation of the roadmap above. Phases 0–2 are small, independent, low-risk, and each individually testable against current `query` output — land them first, in order, and measure on the reference 192-core/8-NUMA machine before deciding whether phases 3–5 (the staged/sparse engine, the larger structural payoff) are still worth their cost. Phases 3–5 are one coordinated change spanning `obikmer`, `obikpartitionner`, and `obicompactvec` — they should not be split across releases mid-way, because the intermediate state (e.g. k-mer-level dedup feeding the old dense `KmerResults`) has no correctness or performance benefit on its own. Phase 6 is unrelated to phases 0–5 and can happen any time, independently, if `rapidgzip-rs` is validated (see [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen)).
Instrumentation is deliberately sequenced *before* the I/O fix (reordering the roadmap's own listed order), because every later phase's justification rests on a measurement ("to be measured, not assumed" appears throughout the roadmap above) — without it, phases 3–5 would be undertaken on faith.
Performance measurement on the reference 192-core/8-NUMA machine is done by the project owner, not from this development environment (macOS, 16 cores — `PartitionRunner`'s NUMA pinning is Linux-only, so even phase 4's mechanism can't be functionally exercised for its actual purpose here). Each phase below is therefore written to be *self-measuring*: the debug-level logging it adds must be enough, on its own, to judge whether that phase's algorithmic choice paid off from a cluster run's logs, without needing to attach a profiler.
### Conventions applied to every phase below
**Debug logging.** Every phase that changes an algorithmic choice (not phase 0, which *is* the logging) adds `tracing::debug!`/`trace!` at points that let a cluster run's logs answer "did this help": counts, ratios, and timings that quantify the specific claim that phase makes — e.g. phase 3 must log how many MPHF `find` calls were saved by k-mer-level dedup (the whole justification for that phase), phase 4 must log per-column scan timings, phase 5 must log actual retained-memory / sparsity ratios achieved. Prefer one structured `debug!` per chunk (fields, not prose) over free-text — the cluster logs will be the only evidence available for judging these choices, so they need to be grep/awk-able, not just readable.
**Unit tests.** This project's convention (`obiread`, `obikseq`, `obidebruinj`, `obicompactvec`, `obilayeredmap`, `obiskio`, `obifastwrite`) is `#[cfg(test)] #[path = "tests/<name>.rs"] mod tests;` at the bottom of the source file, with the actual test code in a sibling `src/tests/<name>.rs`. Neither `obikmer` nor `obikpartitionner` (the two crates phases 3 and 5 touch most) currently have a `src/tests/` directory at all — this needs creating, following the existing pattern exactly, not inventing a new one.
**Workflow (`jj`).** Work happens in a fresh `jj` commit, easy to abandon. `jj new` between phases is reasonable where it helps isolate a phase for review, but only when the working copy compiles at that point (project convention) — phase 3's internal sub-steps (batch dedup change, then `query_layer.rs` split, then the new return shape) will likely not each compile independently since they're one coupled change, so treat "commit boundary" and "plan phase boundary" as related but not forced to match 1:1; use judgement per phase rather than mechanically splitting on every bullet.
### Phase 0 — Instrumentation (prerequisite for measuring every later phase)
**Goal**: make core utilization, throughput, and per-stage timing visible on a real run, so phases 1–5 can be justified with numbers instead of assumption.
- `obikmer/src/cmd/query.rs`: wrap `run()`'s main loop with `obisys::Reporter`/`Stage::start("query")`/`.stop()`, printed at the end via `rep.print()` — same pattern as `index.rs`/`filter.rs`.
- Add an `obisys::spinner("query")` progress bar around the `pipe.apply(...)` loop, with an EMA throughput readout (bases/s or k-mers/s, mirroring `steps::scatter`'s `ema_rate` computation, `scatter.rs:88-118`) and live gauges for "chunks in flight" / "workers busy" — reuse the `AtomicU32` counter pattern from `scatter.rs` (`flat_active`, `transform_active`) rather than inventing a new one.
- Add `max_open_files: Option<usize>` to `QueryArgs` and a `effective_max_open()` method mirroring `CommonArgs::effective_max_open()` (`obikmer/src/cli.rs:90-94`) — needed by phase 1's `throttle()` call. (`QueryArgs` can't just embed `CommonArgs` — it doesn't take `kmer_size`/`minimizer_size`/`partitions`/`level_max`/`theta` from the CLI, those come from the index metadata — so this is a small standalone addition, not a flatten.)
- Add one structured `debug!` per `process_chunk` call: chunk byte size, sequence count, s-mer count, wall time, and (once later phases exist) the fields they add — this single log line is the baseline every later phase's own logging gets compared against.
- **Validation**: none needed beyond "the numbers appear and look sane" — this phase changes no query logic or output.
- **Deliverable used by every phase below**: a before/after throughput and core-utilization measurement on the reference machine.
### Phase 1 — Parallel per-file I/O (fixes root cause of low core utilization)
**Goal**: file opening, decompression, and chunk-boundary parsing run across the `n_workers` pool instead of serially in the pipe's dedicated source thread.
- `obikmer/src/cmd/query.rs`:
- Replace the `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` construction (current `run()`, building `all_chunks`) with `obipipeline::throttle(paths.into_iter(), args.effective_max_open())`, passed as the pipe's `input`.
- Add a new `QueryData::Path(PathBuf)` variant (alongside `Chunk`/`Output`) to carry the throttled path through the pipe's type-erasure mechanism.
- Add a new **first** pipe stage, `Flat`/fallible (`||?`), modeled on `scatter.rs:60-86` and `superkmer.rs:54-65`: given a `Throttled<PathBuf>`, call `read_sequence_chunks_sized(path, chunk_bytes)` and yield each `Rope` chunk, keeping `pw.guard` alive until the file's iterator is exhausted (reuse or adapt `scatter.rs`'s `GuardedIter` wrapper — same lifetime problem, same fix).
- The existing `process_chunk` transform stage becomes the pipe's **second** stage, unchanged in its own logic — it still receives one `Rope` chunk at a time, just no longer all coming from one serial source.
- `make_pipe!` invocation grows from one stage (`Chunk => Output`) to two (`Path => Chunk => Output`).
- Log, per file: time spent waiting on the `throttle()` slot (queueing due to `max_open`), and time spent opening/decompressing/producing the first chunk — this is what directly proves (or disproves) that I/O is now spread across workers instead of serialized.
- **Validation**: run `query` on a small multi-file input, diff output against the pre-change version — content must be identical; **record order across files is not guaranteed to be preserved** even before this change (chunk-level dispatch across `n_workers` already reorders completions), so the diff must be order-insensitive (sort by read id, or compare as sets) if it wasn't already.
- **Measure**: core utilization on the reference machine with several large input files, compare against phase 0's baseline.
### Phase 2 — Genome-aware chunk-size formula (fixes OOM)
**Goal**: `chunk_bytes` reflects actual per-chunk memory (`O(n_genomes)`), not a fixed multiplier.
- `obikmer/src/cmd/query.rs`, `run()`: `n_genomes` and `args.detail` are already computed above the `chunk_bytes` calculation (`n_genomes` at the top of `run()`, before line 407 in the current file) — reorder if needed, then replace:
```rust
let computed = avail / (n_workers as u64 * 16);
```
with a formula that scales the divisor by `n_genomes` (and roughly doubles it when `--detail` is set, since `cov` duplicates the per-genome accumulation): e.g. `per_chunk_multiplier = base_overhead + n_genomes as u64 * BYTES_PER_KMER_PER_GENOME * if detail { 2 } else { 1 }`, replacing the flat `16`. `BYTES_PER_KMER_PER_GENOME` should be derived from `KmerResults`'s actual layout (`4` bytes per `u32` entry in `data`, plus the `bool` in `in_index`, plus `win_min`'s equal-sized buffer) rather than guessed.
- `args.chunk_size` (manual `--chunk-size` override) keeps taking priority, unchanged.
- Log the resolved `chunk_bytes`, `n_genomes`, and the estimated peak per-chunk memory (`chunk_bytes` × the same multiplier used to derive it) once at startup — lets a cluster run confirm the estimate was actually respected, not just that the process didn't get OOM-killed (which could also happen to be true for the wrong reason).
- **Validation**: build a test index with a large `n_genomes` (e.g. hundreds), run `query` with default chunk sizing under a memory limit (`ulimit -v` or a cgroup), confirm it no longer gets OOM-killed and that memory scales as predicted when `n_genomes` grows.
- **Note**: this phase is superseded once phase 5 lands (sparse retained memory no longer scales with `n_genomes × total_kmers` at all) — but it's needed immediately regardless, since phases 3–5 are a bigger, riskier change and users need a working `query` in the meantime.
### Phase 3 — K-mer-level dereplication, staged MPHF/matrix lookup
**Goal**: replace superkmer-level dedup with k-mer-level dedup (roadmap point 5), and split the fused MPHF-find/matrix-fetch (point 4) so stage 1's output is bucketed by layer and MPHF slot (point 6).
- `obikmer/src/cmd/query.rs`:
- Replace `QueryBatch::from_records`'s dedup map (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, current `query.rs:112`) with a per-partition `HashMap<CanonicalKmer, Vec<(seq_idx: u32, pos: u32)>>`, built in the same `SuperKmerIter` pass: superkmer construction and partition routing (`part_idx` from the superkmer's minimizer hash) are unchanged, only the granularity of what gets deduplicated changes — each `CanonicalKmer` within a superkmer is inserted individually instead of the whole superkmer being the dedup key.
- **Verified**: `CanonicalKmer` (`obikseq/src/kmer.rs:390`, `pub type CanonicalKmer = CanonicalKmerOf<KLen>`) — the underlying `CanonicalKmerOf<L>` derives `Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash` (`kmer.rs:269`). Usable as a `HashMap`/`HashSet` key as-is, no change needed.
- `obikpartitionner/src/query_layer.rs`:
- Split `QueryLayer::find_into` (`query_layer.rs:48-67`) into two methods: `find_slot(&self, kmer: CanonicalKmer) -> Option<usize>` (MPHF only, no matrix touch) and keep `fill_row` as-is for phase 4 to call later.
- Replace `query_partition_with`'s inner loop (`query_layer.rs:103-113`) with a version that, for each unique `CanonicalKmer`, calls `find_slot` across the partition's layers (stopping at first hit, same as today), and instead of immediately filling a row, records `(layer_idx, slot)`.
- New return shape for the partition-level query, replacing today's `on_hit(sk_idx, kmer_idx, row)` callback: `HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>` (roadmap point 6) — built directly from the k-mer dedup map's `Vec<(seq_idx,pos)>` values, keyed by the resolved slot instead of the k-mer.
- **This phase alone has no throughput benefit yet** (matrix fetch still happens, just deferred) beyond the k-mer-level dedup itself (fewer MPHF calls when queries have overlapping/repeated k-mers) — its purpose is to produce the input phase 4 needs. Land phase 3+4 together, not phase 3 alone, per the "don't split 3–5 across releases" note above.
- Log, per chunk: total k-mer occurrences vs. unique `CanonicalKmer` count (the dedup ratio — the entire justification for this phase) and the resulting MPHF `find` call count. If the dedup ratio is close to `1.0` on real query data (little redundancy), that's the cluster run telling us this phase wasn't worth it — the logging needs to be able to say that, not just confirm the happy path.
- **Unit tests**: create `obikmer/src/cmd/tests/query.rs` (new `src/tests/` dir for this crate, following the project's `#[cfg(test)] #[path = "tests/query.rs"] mod tests;` convention) and `obikpartitionner/src/tests/query_layer.rs` (likewise new for this crate). Cover: the k-mer-level dedup map construction on synthetic sequences with known repeated/overlapping k-mers (assert unique-kmer count and occurrence lists); the `find_slot`/bucket-by-layer-and-slot construction against a small hand-built `QueryLayer` fixture, asserting the `(layer_idx, slot, seq_idx, pos)` tuples match what the old per-occurrence loop would have produced.
### Phase 4 — Column-major matrix fetch (roadmap points 7–8) — implemented, NUMA parallelism deferred
**Goal (revised during implementation)**: replace `fill_row`-per-hit (row-major, worst-case mmap locality) with a column-major scan. `PartitionRunner` turned out to be the wrong mechanism for this at this call granularity — see below; the column-major fetch itself is implemented and validated, without it.
**What shipped:**
- `obicompactvec`: the per-column accessors this phase needed **already existed** — `PersistentCompactIntMatrix::col_view(c)` and `PersistentBitMatrix::col_view(c)` are public, and `IntSliceView::get(slot)`/`BitSliceView::get(slot)` are public — the original plan underestimated how much of this plumbing the pairwise-distance code (`dump`/`select`/`stats`) had already required. The one real gap: `PersistentBitMatrix::col_view()` panics on the `Implicit` variant (the documented mono-genome fast path, `bitmatrix.rs`). Added `PersistentBitMatrix::get(c, slot) -> u32` (`bitmatrix.rs`), a non-panicking column-major point lookup that returns `1` for `Implicit` regardless of `c` — the smallest surface needed, not a new `col_get` API from scratch.
- `obikpartitionner/src/query_layer.rs`: `query_partition_with` is now two explicit stages, matching roadmap points 6–8: **stage 1** (MPHF-only, per unique k-mer, bucket hits by `(layer_idx, slot)`, emits `QueryHit::Found`) then **stage 2** (per layer with ≥1 hit, column-major: for each genome column `g` in `0..layer.n_cols().min(n_genomes)`, scan that layer's bucketed slots and call `col_value(g, slot)`, emitting `QueryHit::Value(descs, g, value)` on nonzero). `QueryHit` is a single enum delivered through one `FnMut(QueryHit)` callback — an earlier two-closure design (`on_found` + `on_value`) didn't borrow-check, since the caller's single mutable accumulator (`KmerResults`) can't be captured by two separate `FnMut` closures passed to the same call.
- `obikmer/src/cmd/query.rs`: `KmerResults::set` (row-major, whole-row-at-once) replaced by `mark_found` (stage 1: flag a position as indexed, independent of any genome's value) and `set_one` (stage 2: write one genome's value at one position). `QueryStats` extended with `n_columns_scanned`/`n_col_get_calls`, logged per chunk.
- Total `get()`-equivalent calls are unchanged from the row-major version (`n_hits × n_cols` in the worst case, confirmed by `n_col_get_calls` in the debug log) — the win is locality (sequential access within one layer's column at a time, across `mmap`'d regions, instead of jumping across all columns per hit), exactly as predicted.
**What did not ship, and why — `PartitionRunner` is architecturally the wrong tool here:**
Reading `obikindex/src/numa.rs`'s actual `run()` body (not just its doc comments) shows every call spawns a timer thread **plus one OS thread per worker slot on every NUMA node** (`std::thread::scope` + one `s.spawn()` per node per `max_workers`) — on the 192-core/8-NUMA reference machine, that's on the order of 190+ fresh OS threads spawned **per call**. This is fine for its actual, established usage in this codebase (`merge.rs`, `index.rs`'s `build_layers`): one `PartitionRunner::new()` + one `run()` call per command invocation, amortised over a batch of ~256 long-running partitions. It is not fine for `query`'s call pattern: `query_partition_with` runs once per `(chunk, partition)`, potentially thousands of times per second — spawning ~190 OS threads that often to scan a handful of genome columns would very likely cost far more than the row-major approach it's meant to replace. This is exactly the "resolve empirically, don't assume" composition risk the roadmap flagged, just resolved by reading the mechanism's actual cost before wiring it in, rather than by measuring a regression on the cluster after the fact.
The column-major loop in stage 2 is therefore a **plain sequential loop** for now — it captures the whole, provable locality win (roadmap point 8's actual claim) without adding any parallelism mechanism. Genome-column-level parallelism (point 8's "bonus" axis) and partition-level parallelism (point 7) are both deferred — not abandoned. Candidates for a follow-up, once there's a concrete profiling need: (a) `rayon`'s already-warm global pool (`into_par_iter()`) for the column axis specifically — cheap to invoke repeatedly since it doesn't spawn threads per call, though it's the same "naive rayon" pattern `numa_worker_pools.md` warns about for a *different* workload (random pointer-chasing over large hash maps); a column scan's access pattern (sequential reads within one `mmap`'d region) has a different contention profile and hasn't been shown to have the same problem — needs its own measurement, not an assumption either way; (b) restructuring so `PartitionRunner` is invoked once per whole `query` run (or per large batch of chunks) rather than per `(chunk, partition)`, amortising its spawn cost the way `merge`/`build_layers` do — a bigger structural change than this phase's scope.
- Log (implemented): `QueryStats::n_columns_scanned`/`n_col_get_calls`, folded into the existing per-chunk `debug!("k-mer dedup + column-major fetch", ...)` line (`query.rs`) alongside phase 3's dedup counters.
- **Unit tests**: extended `obikpartitionner/src/tests/query_layer.rs` (phase 3's file) — `query_partition_with`'s empty/missing-index paths updated for the new `QueryStats` fields and single-callback signature.
- **Validation performed**: full workspace build + `cargo test --workspace`, zero failures. Functional validation against real indexes: (1) a single-genome index — output byte-identical to pre-phase-4 (same `kmer_count`/`kmer_strict_matches` on every record); (2) the existing 20-genome `benchmark/global_index_presence` index — runs correctly, `n_hits=0` for an unrelated query (expected: no shared k-mers between a plant read and a bacterial reference set), no panics, confirming the `Implicit`/multi-column bounds logic doesn't crash on a real multi-genome, mixed-format index; (3) **the critical correctness case**: built two single-sequence-pair test genomes, merged into one 2-genome index, queried with reads from both — reads from `genomeA` matched **only** `genomeA` (`kmer_count` identical to the pre-dedup occurrence count, zero leakage into `genomeB`'s column) and vice versa. This is the test that would have caught a column-index mixup, an off-by-one in `n_cols`, or cross-genome bleed from the stage-1/stage-2 split — it passed cleanly.
- **Not yet done**: the microbenchmark comparing column-major vs. the old row-major access pattern's wall time / page-fault counters on a large-`n_genomes` layer — needs a realistically large multi-genome index and, for the page-fault counters specifically, Linux (not available from this development environment). Left for cluster validation alongside phases 1–3's own pending measurements.
### Phase 5 — Sparse Findere rework (roadmap point 9)
**Goal**: replace the dense `KmerResults`/`win_min` sliding-window scan with one operating on phase 4's sparse per-genome output.
- `obikmer/src/cmd/query.rs`, `process_chunk`:
- Remove `KmerResults` (`query.rs:157-202`) and the dense `win_min` allocation (`query.rs:290-291`, sized `max_n_kmers × n_genomes`).
- Keep a lightweight dense `in_index: Vec<bool>` per chunk (sized `total_kmers`, independent of `n_genomes`) from phase 3's stage 1 — still needed for `kmer_missing` bookkeeping (leftmost-s-mer-of-window membership test), which phase 4's sparse structure doesn't carry (a k-mer with no genome hit has no entry there at all).
- New per-`(seq_idx, genome)` scan: for each genome's `Vec<(seq_idx, pos, count)>` (sorted, per phase 4), group by `seq_idx` (contiguous after sort), then within each sequence's positions detect runs of `pos, pos+1, pos+2, ...` of length ≥ `z`; within each run, the existing monotone-deque window-minimum logic (`query.rs`'s current `dq` loop, conceptually unchanged) applies — but the deque now only scans real entries in the run, never zero-filled gaps.
- Update `SeqAcc` accumulation and `emit_batch` to consume this per-genome sparse iteration instead of `results.val`/`results.is_in_index`.
- `--detail`/`cov`: build sparsely during the same scan (only positions with a confirmed contribution get an entry), densify into the `[u32]` JSON array only in `emit_batch`, only for genomes/sequences actually being serialized (per roadmap point 9's note, `query.rs:304-308`'s current dense allocation goes away).
- Log, per chunk: total sparse entries retained vs. what the old dense `KmerResults` would have allocated (`total_smers × n_genomes`) — the sparsity ratio is this phase's entire reason for existing, so it must be directly visible in the logs, not inferred from process RSS. Also log the run-detection stats (number of runs found, average run length) — a low average run length relative to `z` would mean most positions still fail to form a full window, worth knowing.
- **Unit tests**: `obikmer/src/cmd/tests/query.rs` (extended from phase 3) — the property test described below is the primary deliverable here, not an afterthought; write it as an actual `#[test]` (or a small internal fuzz/property-style loop over randomized fixtures if a property-testing crate isn't already a dependency — check before adding one, per this project's dependency-approval rule) rather than a one-off manual comparison.
- **Validation — this is the correctness-critical phase**: property-test comparing old (dense, pre-phase-3) and new (sparse) implementations on the same randomized input/index fixtures, asserting identical `kmer_count`, `kmer_missing`, `kmer_strict_matches`, and (with `--detail`) `coverage` for every sequence. Keep both implementations compiled side by side (behind a debug-only flag or a temporary parallel code path) only for the duration of this validation; delete the dense path once parity is confirmed — per this project's own convention, superseded code is not kept "just in case."
- **Update `docmd/architecture/query.md` itself**: once this phase lands, the "Findere z-window filter" section (which currently — correctly — describes the dense deque-over-`0..n_smers` scan) needs another pass to describe the sparse run-detection algorithm instead, as already flagged when this phase was discussed.
**Implemented as planned, no deviations discovered this time.** What shipped:
- `KmerResults` removed entirely, replaced by `SmerIndex` (`in_index: Vec<bool>` + `offsets`, unchanged size/purpose, renamed since it's no longer "results" — just the O(1)-per-position "was this k-mer found at all" bookkeeping) and `by_genome: Vec<Vec<(seq_idx, pos, value)>>` (one empty `Vec` per genome until a hit arrives — genomes with zero hits in a chunk cost nothing beyond the outer `Vec`'s own allocation).
- New `sparse_findere_for_genome(hits, z, presence, threshold) -> (Vec<ConfirmedHit>, n_runs, total_run_len)` (`query.rs`): sorts one genome's raw hits by `(seq_idx, pos)`, detects maximal runs of consecutive `pos` within one sequence, runs the same monotone-deque window-minimum as before but scoped to each run (run-relative indices for eviction, absolute `pos` for computing `pos_out`). Presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw) is applied inside this function, once per confirmed hit, rather than later during accumulation.
- `process_chunk` restructured into three passes after the partition loop: (1) run `sparse_findere_for_genome` per genome, collecting `confirmed_by_genome` and run-detection stats; (2) accumulate `genome_totals` directly from `confirmed_by_genome` and mark a `confirmed_any: Vec<bool>` (sized `total_kmers_out`, not `× n_genomes`); (3) a position-only pass (`O(total_kmers_out)`, no genome factor) computing `kmer_count`/`kmer_missing` from `confirmed_any` + `SmerIndex`. `cov` (`--detail`) is populated by re-scanning `confirmed_by_genome` — only when `--detail` is actually set, otherwise skipped entirely.
- Debug log added (`"sparse Findere"`): `n_dense_would_be` (`n_occurrences × n_genomes` — what the deleted dense path would have allocated), `n_sparse_entries` (what's actually retained), `n_runs`/`avg_run_len` (per the plan's ask, to see whether hits mostly fail to form complete windows).
- **Unit tests**: `sparse_findere_matches_dense_reference_on_random_inputs` (`obikmer/src/cmd/tests/query.rs`) — 200 randomized cases (sequence count/length, `z`, presence/count mode, threshold, hit density from sparse to fully-dense) comparing `sparse_findere_for_genome` against `dense_reference_findere`, a faithful reimplementation of the deleted dense algorithm kept only as a test-local correctness oracle (no property-testing crate added — checked first, none was a workspace dependency; a small `std`-only xorshift64 PRNG stands in for one, deterministic and dependency-free). All 200 cases pass.
- **Functional validation performed**: full workspace build + `cargo test --workspace`, zero failures. End-to-end against real indexes: baseline output (no flags) unchanged from pre-phase-5 recorded values on the same fixtures; `--count-missing` correct (`kmer_missing: 0` on a self-match); `--detail` correct — coverage array length matches `kmer_count`, and critically, re-ran the two-genome cross-contamination check from phase 4 with `--detail --count-missing`: `genomeA` reads show coverage sum `106` for `genomeA` and `0` for `genomeB` (and vice versa) — confirms the sparse-to-dense `cov` reconstruction doesn't leak across genomes either, not just the scalar `kmer_strict_matches` path.
- This phase's roadmap item ("update the Findere z-window filter section") — done, see above; the "Algorithm" section's pseudocode was also updated, since it still named `KmerResults`/`SKDesc` from before phases 3–4.
### Phase 6 — Parallel gzip decompression (independent, optional)
Tracked separately in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen); parked pending validation of `rapidgzip-rs` on real data. Not a dependency of, or a dependency for, phases 0–5 — `xopen` is shared infrastructure (`obiread`), phase 1 benefits from it but doesn't require it (phase 1 parallelises *across* files; this phase would additionally parallelise *within* one large file).
### Cross-cutting risks
- **Thread-budget oversubscription** (phase 4): the single biggest unresolved design question in this whole plan — see phase 4's composition note. Should be settled with real measurements early in phase 4, not assumed from the design alone.
- **`obicompactvec` API surface growth** (phase 4): new public per-column accessors are additive (existing `fill_row`/`row` stay for other callers — `dump`, `select`, distance computations) — no breaking change expected, but worth checking `obicompactvec`'s other callers aren't already relying on `fill_row` being the only/cheapest access path in a way that would make maintaining two access patterns (row-major and column-major) a real maintenance cost rather than a one-off addition.
- **`PersistentBitMatrix::Implicit`'s hardcoded `n_cols: 1` — resolved, not a bug.** `LayerMeta`'s own doc comment (`obicompactvec/src/layer_meta.rs:1-9`) states it is written "alongside `mphf.bin`" and read by `PersistentBitMatrix::open` "to determine `n_rows` for **the implicit (mono-genome presence/absence) case**" — i.e. `Implicit` is a documented single-genome fast path (no presence matrix needed when there is trivially one genome), not a generic "no matrix built yet" fallback. `n_cols: 1` is correct by design for the case it's meant to handle. Phase 4's column loop is safe as planned — this was worth checking once, doesn't need further action.
+105
View File
@@ -0,0 +1,105 @@
# Rebuild / filter — column-first design
## Problem with the current two-pass design
`rebuild_partition` currently makes **two full passes** over source data:
**Pass 1** — read unitigs → MPHF lookup (source) → read row (108 values) → apply filter → push kmer into `GraphDeBruijn`, **discard row**.
**Pass 2** — read unitigs again → MPHF lookup again → read row again → for each passing kmer, look up slot in new MPHF → fill column builders.
Both passes do random access into the source matrix: for each kmer, the MPHF returns a slot, then we read 108 values scattered across 108 column positions. This is cache-hostile even with a packed matrix (`.pbmx`), because the matrix is column-major: consecutive row reads jump across the file.
## Memory budget
The `keep` bitvector costs **1 bit per slot**. With 256 partitions and realistic kmer counts, each partition holds at most a few tens of millions of slots → a few MB per bitvector. Even in the absolute worst case (800 M slots), it stays under 100 MB. This is negligible.
The `slot_map` option (Option B, 8–16 bytes per slot) is heavier but still bounded: at 15 M slots and 8 bytes, that is 120 MB per partition, acceptable for a single worker.
## Key observation
**The filter operates on column values, not on kmers.** A filter like `--max-outgroup-count 0` only needs to know, for each slot, whether any outgroup column is non-zero. It does not need to know which kmer occupies that slot.
This means filtering can be done as a **sequential column scan** that produces a `keep: BitVec[n_slots]` — no MPHF lookups, no kmer knowledge, perfectly cache-friendly.
## Proposed single-scan design
### Step 1 — column scan → `keep` bitvector
```
for each column c in source matrix:
read column c sequentially (one mmap range)
update keep[slot] according to filter contribution of column c
```
For `GroupQuorumFilter` with ingroup/outgroup:
- ingroup columns: count presence per slot → `ingroup_count[slot]`
- outgroup columns: `keep[slot] &= (value[slot] == 0)` (early-exit possible)
Result: `keep: BitVec` of size `n_slots`, computed with purely sequential IO.
### Step 2 — unitig scan → kept kmers + new MPHF
```
for each kmer in unitig files:
old_slot = old_MPHF(kmer)
if keep[old_slot]:
push kmer into new GraphDeBruijn
record (old_slot, kmer) ← or just old_slot in order
```
Build new MPHF from `GraphDeBruijn` via `materialize_layer`.
### Step 3 — fill new matrix
Two sub-options:
**Option A — from recorded (old_slot, kmer) pairs:**
```
for each (old_slot, kmer) in recorded list:
new_slot = new_MPHF(kmer)
for each column c:
new_matrix[new_slot, c] = old_matrix[old_slot, c]
```
Memory cost: `n_kept × (8 + 8)` bytes for `(old_slot: usize, kmer: CanonicalKmer)`.
For species-specific filters, `n_kept` is small. For unfiltered rebuild, `n_kept = n_slots`.
**Option B — column-by-column copy using old→new slot mapping:**
Precompute `slot_map: Vec<Option<usize>>` of size `n_slots`:
- For each kmer in unitig file: `slot_map[old_MPHF(kmer)] = Some(new_MPHF(kmer))`
Then for each source column:
```
read source column sequentially
for each slot where slot_map[slot] = Some(new_slot):
write value to new column at new_slot
```
Memory cost: `n_slots × sizeof(usize)` for the slot map (one usize per source slot).
IO pattern: sequential read of each source column → random write into new column builders.
Option B avoids storing kmer values and works uniformly regardless of filter selectivity.
## Comparison
| | Current | Proposed |
|---|---|---|
| Disk reads | 2× unitigs + 2× random matrix | 1× columns (sequential) + 1× unitigs |
| MPHF lookups (source) | 2× N_kmers | 1× N_kept (step 2) or 0 (option B, col scan only) |
| Cache behavior | poor (random row access) | good (sequential column scan) |
| Extra memory | none | slot_map (option B) or (old_slot, kmer) list (option A) |
## Files to modify
- `src/obikpartitionner/src/rebuild_layer.rs` — `rebuild_partition` and `iter_src_layers`
- Possibly `src/obicompactvec/` — add column iterator API if not already present
- `src/obilayeredmap/` — check if per-column sequential access is exposed on `SrcLayerData`
## Open questions
- Does `SrcLayerData` expose per-column sequential iteration, or only `lookup(kmer, n_genomes)` random access?
- For option B: are new column builders writable in random-slot order (i.e. `set_val(slot, value)` without sequential constraint)?
- For `GroupQuorumFilter` specifically: can the filter be decomposed into independent per-column contributions, or does it need the full row?
+16
View File
@@ -107,3 +107,19 @@ stateDiagram-v2
`restart` is updated each time a `+` is found. When any state fails its expected input, the scan jumps back to `restart` and continues from there — guaranteeing that a `@` in a quality line cannot be accepted as a record start, because the `\n+\n` structure immediately following it (going backward) will not be found.
Returns the byte offset of the `@` that starts the last complete record.
---
## Future work — parallel gzip decompression in `xopen`
`obiread::xopen` (`xopen.rs`) decompresses gzip via `niffler` → `flate2`, which is single-threaded (standard DEFLATE has no parallel-decodable structure). For large local gzip inputs this single-threaded decompression can become the throughput bottleneck feeding the `query`/`index`/`superkmer` pipelines, since chunk/page production for a given file is serialized ahead of the worker pool.
Candidate: special-case local, on-disk, gzip-magic-detected paths in `open_raw`/`xopen` to use [`rapidgzip-rs`](https://github.com/alekseizarubin/rapidgzip-rs) (`ReaderBuilder::new().parallelism(n).open(path)`, implements `Read + Seek`) instead of `niffler`, keeping `niffler` for every other case: `stdin` (`-`), HTTP(S) sources, and all non-gzip formats (bzip2, xz, zstd — less used in practice here).
Constraints identified so far (not yet validated against real data):
- Branch point must move earlier than the current `decompress()` call in `open_raw` — rapidgzip's fast path needs the file **path**, not an already-opened generic `Read`, so the gzip/local-file detection has to happen before the generic `File::open` + `niffler::send::get_reader` path is taken.
- `stdin` and HTTP sources are not seekable — they stay on `niffler` regardless; the gain only applies to local on-disk `.gz` files.
- `rapidgzip-sys` vendors a native C++ engine: requires CMake ≥ 3.17, a C++17 compiler, and `nasm` on x86 targets — a real build-toolchain addition, not just a pure-Rust crate.
- Low maturity of the Rust binding at review time (2 GitHub stars, ~15 commits, April 2026 latest release) — the underlying C++ engine is validated (HPDC 2023 paper), but the binding itself has limited production track record.
Decision: parked for now. Before adopting, validate on real data: throughput vs. `niffler` on representative large `.gz` inputs, and byte-for-byte correctness of decompressed output.
+320
View File
@@ -0,0 +1,320 @@
# Kmer filtering and ingroup/outgroup predicates
The `filter`, `dump`, and `unitig` commands share the same filtering system,
implemented as a shared `FilterArgs` clap argument group embedded in each command
via `#[command(flatten)]`. Filters select k-mers based on per-genome quorum
counts, optionally restricted to **ingroup** and **outgroup** genome sets derived
from genome metadata. All rules described here apply identically to all three commands.
`filter` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical concept paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
Stored taxonomy values always start with `/` (the root of the path).
Query patterns do **not** need to start with `/` — a leading `/` is an optional
start anchor, not a requirement.
| Pattern form | Semantics |
|---|---|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B |
| `A/B$` | value ends with A then B |
| `/A/B$` | value is exactly A then B |
| `A@x/B` | A with class `x` followed by B with any class |
- `taxon~/Betulaceae/Betula` matches any path that starts with `Betulaceae` then `Betula`.
- `taxon~Betula` matches any path containing `Betula` as a segment, anywhere.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)` → `in_result`
2. Evaluate `OR(outgroup predicates)` → `out_result`
3. If `in_result = true` → **Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true` → **Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
### Negative counts — offset from group size
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
down from the group size `n`, resolved at run time once `n` is known:
| Value | Effective threshold |
|-------|---------------------|
| `N ≥ 0` | literal absolute count `N` |
| `-x` (x > 0) | `max(1, n − x)` — "all but x" |
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
a quorum relative to the group size that a plain fraction cannot state exactly
(e.g. "present in every genome except at most one" is `n−1`, which is `0.9` for
`n = 10` but `0.857…` for `n = 7`).
The threshold is **floored at 1**, never 0: the negative form always keeps
constraining the group. Without the floor, `--min-count -1` on a singleton
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
constraint; the floor makes it `1` ("present in that one genome") instead.
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
`-1`.
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
> genome), a negative count still resolves to `1`, an impossible constraint that
> rejects every k-mer. This is consistent with an empty group letting nothing
> through, but differs from the "no constraint" behaviour of the fraction flags.
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
> **Rule**: declaring a group activates the smart default **only if no quorum flag for that group is explicitly set**.
> As soon as any quorum flag for a group is present on the command line, all defaults for that group revert to no-op values.
| `--ingroup` | Any ingroup quorum flag? | `--min-frac` default |
|-------------|--------------------------|----------------------|
| not set | — | 0.0 (no-op) |
| set | no | **1.0** — all ingroup genomes must carry the k-mer |
| set | yes | 0.0 — user controls quorum explicitly |
| `--outgroup` | Any outgroup quorum flag? | `--max-outgroup-count` default |
|--------------|---------------------------|-------------------------------|
| not set | — | outgroup size (no-op) |
| set | no | **0** — no outgroup genome may carry the k-mer |
| set | yes | outgroup size — user controls quorum explicitly |
"Any ingroup quorum flag" means any of: `--min-count`, `--max-count`, `--min-frac`, `--max-frac`.
"Any outgroup quorum flag" means any of: `--min-outgroup-count`, `--max-outgroup-count`, `--min-outgroup-frac`, `--max-outgroup-frac`.
**Why this rule?** Setting any quorum flag signals explicit intent — the defaults are there to help when the user omits quorum entirely, not to interfere with deliberate constraints. Mixing implicit and explicit quorum on the same group would risk silent incoherence (e.g. `--max-count 0` with an implicit `--min-frac 1.0`).
All other bounds default to 0 / group size / 0.0 / 1.0 regardless of whether groups are declared.
### Validation
After resolving defaults, the following are checked and cause an immediate error:
| Condition | Error |
|-----------|-------|
| `--min-count > --max-count` | incoherent bounds |
| `--min-frac > --max-frac` | incoherent bounds |
| `--min-outgroup-count > --max-outgroup-count` | incoherent bounds |
| `--min-outgroup-frac > --max-outgroup-frac` | incoherent bounds |
| any fraction outside `[0.0, 1.0]` | invalid value |
The check applies to the **effective** values (after defaults are resolved), so an explicit `--max-frac 0.5` with an implicit `--min-frac 1.0` would have been caught — but the rule above prevents that situation from arising in the first place.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
### Conservative rounding of fraction thresholds
When a fraction threshold `F` is applied to a group of size `N`, the effective
integer threshold is determined by the direction of the bound:
| Bound | Effective count | Rounding | Rationale |
|-------|----------------|----------|-----------|
| `--min-frac F` | k-mer in ≥ ⌈F·N⌉ genomes | **ceil** | stricter — a kmer present in exactly ⌊F·N⌋ genomes does not meet the fraction |
| `--max-frac F` | k-mer in ≤ ⌊F·N⌋ genomes | **floor** | stricter — a kmer present in ⌈F·N⌉ genomes already exceeds the fraction |
The same rule applies symmetrically to `--min-outgroup-frac` (ceil) and
`--max-outgroup-frac` (floor). The outgroup direction is not inverted: the
conservative rounding depends only on whether the bound is a minimum or a
maximum, not on which group it applies to.
**Example** — `--min-frac 0.5` with an ingroup of 3 genomes:
`⌈0.5 × 3⌉ = ⌈1.5⌉ = 2` → at least 2 of 3 ingroup genomes must carry the k-mer.
**Implementation note** — the filter evaluates `n / denom < min_frac` directly
(integer `n`, float comparison) rather than pre-computing `⌈F·N⌉`. This is
mathematically equivalent for integer counts: `n / N < F` ↔ `n < F·N` ↔
`n ≤ ⌈F·N⌉ − 1` ↔ `n < ⌈F·N⌉`. No explicit rounding is needed.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer filter src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
(`-1` = `n−1`) and absent from *all but one* of the outgroup:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count -1 \
--max-outgroup-count -1
```
To dump only k-mers specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Command-specific options
### `dump --head N`
Stops output after the first N k-mers that pass all active filters.
Iteration terminates immediately — subsequent partitions and layers are not scanned.
Useful for quick inspection of large indexes without loading the entire dataset.
```sh
obikmer dump myindex --head 100
obikmer dump myindex --head 20 --ingroup "species=Betula_nana" --min-count 1
```
### `distance --presence-threshold N`
When computing Jaccard distance on a **count index**, a k-mer is considered present in a genome if its count is ≥ N (default 1).
This option is independent of the `--presence-threshold` used in filtering.
```sh
# Jaccard treating kmers with count ≥ 2 as present
obikmer distance myindex --metric jaccard --presence-threshold 2
```
This parameter has no effect on presence/absence indexes (where values are already 0/1) or on metrics other than Jaccard.
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `FilterArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `filter`, `dump`, and `unitig` all go through this single
entry point.
+207
View File
@@ -0,0 +1,207 @@
# Merge parallelism and memory pressure
## Problem observed
Running `obikmer merge` over 109 indexes (108 sources + 1 bootstrap) on a 192-core machine
produces a fatal OOM during the `merge_partitions` stage:
```
memory allocation of 9126805520 bytes failed
```
A single allocation of ~8.5 GB fails. This is not an aggregate; it is one `malloc` call
from hashbrown during a HashMap resize.
---
## Root cause
### The merge pipeline per partition
```
source unitigs.bin
→ iter_indexed_canonical_kmers()
→ GraphDeBruijn::push() ← HashSet<u64> + 1 byte flags, all in RAM
→ compute_degrees_and_mark_starts()
→ try_for_each_unitig()
→ unitigs.bin (new layer)
→ Layer::build() → MPHF + evidence
```
`GraphDeBruijn` is a `FastHashMap<CanonicalKmer, AtomicU8>` — a `HashSet<u64>` with
one flag byte per node. Neighbor lookup is implicit: 4 probes into the same map.
No edges are stored. The full kmer set of one partition must reside in RAM
simultaneously to compute degrees and mark unitig starts.
The matrix builders that follow (pass 2) are mmapped files — they do **not** consume
significant RAM. The pressure is entirely in pass 1.
### Unbounded Rayon parallelism
With 192 cores, Rayon ran up to 192 partitions concurrently. Each partition built its
own `GraphDeBruijn` accumulating all kmers absent from the destination. Peak memory =
192 × peak_partition_hashset.
### The 8.5 GB single allocation
hashbrown allocates the entire backing array in one call when rehashing.
At load factor 7/8: `capacity × (sizeof(K,V) + 1 control byte)`.
For `(u64, AtomicU8)` with alignment: ~16 bytes per slot.
```
9 127 MB / 16 bytes ≈ 570 M slots → ~380 M new kmers in one partition
```
Plausible for the largest partition of 108 Salix/Betula sources (~450 Mbp each).
---
## Partition size distribution
`obikmer utils --partition-stats` measures the sum of `unitigs.bin` file sizes
per partition across all source indexes (pure `stat()` syscalls, negligible cost).
Observed on a 9-genome pilot (256 partitions):
| Stat | Value |
|---|---|
| min | 30.5 MB |
| max | 232.1 MB |
| mean | 40.1 MB |
| median | 37.2 MB |
| p95 | 47.1 MB |
| max/median ratio | 6.23× |
The distribution is **bimodal with a heavy tail**:
- 238/256 partitions in a narrow 30–50 MB band
- 4 structurally extreme partitions (3–6× the median): 221, 233, 135, 191
These correspond to minimizers over-represented in repetitive regions shared across
all sources. They are extreme in every run on this dataset.
With 109 sources, outlier partitions do not scale linearly: only kmers **absent from
the destination** enter the GraphDeBruijn, and inter-source overlap is high for closely
related species. Partition 221 is the likely trigger for the 8.5 GB crash.
---
## Solution: LFD scheduling + memory budget semaphore
### Principle
Pre-sort partitions by **decreasing estimated size** (First Fit Decreasing — FFD),
then schedule them through a **continuous memory budget semaphore**. Each worker
acquires an estimated cost before starting and releases it on completion.
Large partitions run first when the full budget is available; small partitions fill
the gaps. No hard outlier threshold is needed.
### `MemoryBudget` (`obisys`)
```rust
pub struct MemoryBudget { … }
impl MemoryBudget {
pub fn new(total: u64) -> Self;
pub fn acquire(&self, cost: u64); // blocks until budget available
pub fn release(&self, cost: u64);
pub fn peak_active(&self) -> usize;
}
```
Non-deadlock guarantee: when `active == 0`, acquire always succeeds regardless of cost.
Without this, a partition whose estimated cost exceeds the total budget would block forever.
### Adaptive expansion factor
The expansion factor converts raw `unitigs.bin` bytes into an estimated GraphDeBruijn
RAM footprint. hashbrown stores each kmer as `(u64, AtomicU8)` ≈ 16 bytes/kmer at 7/8
load factor; unitig files encode ≈ 2 bits/base. The ratio depends on average unitig
length (short unitigs: ~2×; long unitigs: up to ~50×).
**Phase 1 — sequential pilot (worst partition)**
The largest partition runs alone first. Its actual `g.len()` seeds the expansion factor
before any parallel job starts. `FALLBACK_EXPANSION = 4×` is used only for empty partitions.
```rust
let worst_g_len = dst_partition.merge_partition(worst_id, …)?;
// ↑ now returns SKResult<usize> (was SKResult<()>)
let seed_expansion = worst_g_len as u64 * 16 * 1000 / worst_bytes;
let max_expansion = AtomicU64::new(seed_expansion);
```
**Phase 2 — parallel with adaptive updates**
```rust
order[1..].into_par_iter().for_each(|&i| {
let cost = partition_sizes[i] * max_expansion.load(Relaxed) / 1000;
budget.acquire(cost);
let g_len = dst_partition.merge_partition(i, …)?;
budget.release(cost); // releases estimated cost, not actual
let actual = g_len as u64 * 16 * 1000 / partition_sizes[i];
max_expansion.fetch_max(actual, Relaxed); // always pessimistic (max)
});
```
`budget.release(cost)` uses the estimated cost, not the actual one. The budget tracks
reservations, not physical RAM; each partition pays what it promised at acquisition.
**On the safety margin**
There is no separate multiplier `k`. It is redundant with `budget_fraction`: both
reduce effective concurrency by the same amount. A single parameter is easier to
calibrate. `budget_fraction = 0.5` (default) reserves half of available RAM for the
OS, MPHF build, pass 2, and estimation error.
`--budget-fraction` is exposed as a CLI flag — the only escape hatch for pathological
cases (extreme repetitive content, unusually long unitigs) that still cause OOM.
### RAM source
`obisys::available_memory_bytes()` — wraps `sysinfo::System::available_memory()`,
falls back to `total / 2` on macOS when the memory compressor returns 0.
---
## Diagnostic report
After the parallel phase, `merge_partition` emits a structured report via `tracing::info!`:
```
─── merge_partitions memory report ───
available RAM : 512.0 GB budget 50% = 256.0 GB
expansion factor — seed: 4.2× final max: 6.1× (mean: 1.8× median: 1.6×)
peak concurrent workers: 42
expansion factor distribution (256 partitions with data):
0.50× – 1.25× │██████████████████████████████ 148
1.25× – 2.00× │████████████████████████ 82
…
5.50× – 6.25× │█ 2
top partitions by actual expansion factor:
partition 221 : 6.10× (232.1 MB unitigs → 48M kmers, reserved at 4.20×)
partition 135 : 5.82× (127.3 MB unitigs → 24M kmers, reserved at 4.20×)
…
──────────────────────────────────────
```
Fields useful for diagnosis:
| Field | Interpretation |
|---|---|
| `seed` vs `final max` expansion | gap indicates partitions with higher expansion than the worst-by-size |
| `reserved at X×` | the factor used at acquisition; if much lower than actual, the budget was under-reserved for that partition |
| `peak concurrent workers` | effective parallelism achieved under the budget constraint |
| `mean` / `median` expansion | typical dataset characteristic; stable across runs on the same data |
---
## Parameters
| Parameter | Default | CLI flag | Notes |
|---|---|---|---|
| `fallback_expansion` | 4× | — | seed for empty partitions only |
| `budget_fraction` | 0.5 | `--budget-fraction` | reduce if OOM persists |
| RAM source | `obisys::available_memory_bytes()` | — | falls back to `total/2` on macOS |
+533
View File
@@ -0,0 +1,533 @@
# obicompactvec — Complete Reference
## Module structure
```
src/obicompactvec/src/
lib.rs public re-exports
views.rs BitSliceView<'a>, IntSliceView<'a> — zero-copy read views
traits.rs ColumnWeights, CountPartials, BitPartials (matrix aggregation)
bitvec.rs PersistentBitVec, PersistentBitVecBuilder, BitIter
reader.rs PersistentCompactIntVec (read-only)
builder.rs PersistentCompactIntVecBuilder (read-write)
tempintvec.rs TempCompactIntVec, TempCompactIntVecBuilder (temp-file-backed)
tempbitvec.rs TempBitVec, TempBitVecBuilder (temp-file-backed)
bitmatrix.rs PersistentBitMatrix, PersistentBitMatrixBuilder
intmatrix.rs PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder
colgroup.rs ColGroup, MatrixGroupOps trait
format.rs file format constants, encode/decode helpers
layer_meta.rs LayerMeta (column metadata)
meta.rs matrix metadata
```
```mermaid
graph TD
views --> bitvec
views --> builder
views --> tempbitvec
views --> tempintvec
views --> bitmatrix
views --> intmatrix
format --> reader
format --> builder
reader --> intmatrix
reader --> tempintvec
builder --> intmatrix
builder --> tempintvec
bitvec --> tempbitvec
bitvec --> bitmatrix
tempintvec --> intmatrix
tempintvec --> bitmatrix
tempbitvec --> intmatrix
tempbitvec --> bitmatrix
colgroup --> intmatrix
colgroup --> bitmatrix
layer_meta --> bitmatrix
layer_meta --> intmatrix
meta --> bitmatrix
meta --> intmatrix
```
---
## Compact int encoding
All integer vectors use the same two-tier encoding regardless of storage backend.
**Primary array** — one `u8` per slot:
- Values **0–254** are stored directly. No overhead.
- Value **255 is a sentinel**: the slot's actual value is ≥ 255 and lives in the overflow store.
**Overflow store** — maps slot index to a `u32` value ≥ 255:
- In `PersistentCompactIntVecBuilder`: a `HashMap<usize, u32>` in RAM.
- In `PersistentCompactIntVec` (reader): a sorted `[(slot: u64, value: u32)]` array in the mmap, with a sparse L1-resident index for binary search.
```mermaid
flowchart LR
slot --> P["primary[slot]: u8"]
P -->|"< 255"| V["value = byte (0–254)"]
P -->|"= 255 sentinel"| OV["overflow store"]
OV -->|"Builder"| HM["HashMap&lt;usize, u32&gt;\nin RAM"]
OV -->|"PersistentCompactIntVec"| SA["sorted [(slot,value)] in mmap\n+ sparse L1 index"]
```
**Key property — sentinel 255 = +∞ on `u8`:**
- `min(a, 255) = a` for all `a ≤ 254` → correct when only one side is overflow
- `max(a, 255) = 255` → correct sentinel when either side is overflow
- Only the **both-overflow** case requires reading actual values from the overflow store.
In practice, k (overflow count) ≪ n (total slots). Observed genomic data: ~0.07% of kmer slots are in overflow.
---
## View types
The previous trait hierarchy (`BitSlice`, `BitSliceMut`, `IntSlice`, `IntSliceMut`) has been replaced by two concrete zero-copy view structs with inherent methods. Views are **`Copy`** — passing them is free. All read operations live on these two types.
### `BitSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct BitSliceView<'a> { pub(crate) words: &'a [u64], pub(crate) n: usize }
```
Bit `i` is at `words[i >> 6]` bit `i & 63` (LSB-first). Padding bits in the last word are zero.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `get(slot)` | O(1) |
| `count_ones()` | POPCNT per word, O(n/64) |
| `count_zeros()` | `n − count_ones()`, O(n/64) |
| `iter() -> BitSliceIter<'a>` | O(1) setup, O(n) iteration |
| `partial_jaccard_dist(other: BitSliceView)` | `(a&b).popcount`, `(a\|b).popcount` per word, O(n/64) |
| `jaccard_dist(other: BitSliceView)` | from partial, O(n/64) |
| `hamming_dist(other: BitSliceView)` | `(a^b).popcount` per word, O(n/64) |
`BitSliceIter<'a>`: word-level scan; one word per 64 iterations.
### `IntSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct IntSliceView<'a> {
pub(crate) primary: &'a [u8],
pub(crate) overflow_raw: &'a [u8], // sorted [(slot:u64, value:u32)] entries
pub(crate) n_overflow: usize,
pub(crate) n: usize,
}
```
`overflow_raw` contains `n_overflow` entries of `OVERFLOW_ENTRY_SIZE` bytes each, sorted by slot. The sort invariant is established at `close()`/`freeze()` time.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `primary_bytes()` | O(1) |
| `overflow_entries() -> impl Iterator<(usize,u32)>` | O(n_overflow) iteration |
| `get(slot)` | O(1) primary; binary search O(log k) for overflow slots |
| `iter() -> IntSliceViewIter<'a>` | merge scan, O(n + k) |
| `sum()` | byte scan + overflow, O(n + k) |
| `count_nonzero()` | byte scan, O(n) |
| Distance methods (`bray_dist`, `euclidean_dist`, `jaccard_dist`, …) | O(n + k) |
`IntSliceViewIter<'a>`: merge scan using `overflow_pos` index. Requires sorted overflow — guaranteed by the construction lifecycle.
**Builder `view()` vs reader `view()`:** `PersistentCompactIntVecBuilder` stores overflow as an unsorted `HashMap`, not raw bytes. Its `view()` returns an `IntSliceView` with `overflow_raw = &[]` and `n_overflow = 0`. This is intentional — the view is primarily useful after `freeze()`. During building, callers that need overflow use `overflow_entries()` directly.
---
## Concrete types
```mermaid
classDiagram
class BitSliceView {
+words: &[u64]
+n: usize
+get(slot) bool
+count_ones() u64
+iter() BitSliceIter
+jaccard_dist/hamming_dist(other: BitSliceView)
}
class IntSliceView {
+primary: &[u8]
+overflow_raw: &[u8]
+n_overflow: usize
+n: usize
+get(slot) u32
+iter() IntSliceViewIter
+overflow_entries() Iterator
+bray_dist/euclidean_dist/…(other: IntSliceView)
}
class PersistentBitVec {
-mmap: Mmap
-n: usize
+view() BitSliceView
+get(slot) bool
+count_ones/zeros() u64
+iter() BitIter
+partial_jaccard_dist(&Self) (u64,u64)
+jaccard_dist/hamming_dist(&Self) …
}
class PersistentBitVecBuilder {
-mmap: MmapMut
-n: usize
+view() BitSliceView
+set(slot, bool)
+or/and/xor/not(BitSliceView)
+copy_from(BitSliceView)
+close() / finish() → PersistentBitVec
}
class PersistentCompactIntVec {
-mmap: Mmap
-n: usize
-n_overflow: usize
-step: usize
-index: Vec~(usize,usize)~
+view() IntSliceView
+get(slot) u32
+iter() Iter
+sum/count_nonzero() u64
+bray_dist/euclidean_dist/… (&Self)
}
class PersistentCompactIntVecBuilder {
-mmap: MmapMut
-n: usize
-overflow: HashMap~usize,u32~
+view() IntSliceView
+set(slot, u32) / get(slot) u32
+inc / inc_present / inc_present_fast
+inc_predicate / inc_predicate_fast
+add/min/max/diff/mask_with(…View)
+primary_bytes/primary_bytes_mut()
+close() / finish() → PersistentCompactIntVec
}
PersistentBitVec --> BitSliceView : view()
PersistentBitVecBuilder --> BitSliceView : view()
PersistentCompactIntVec --> IntSliceView : view()
PersistentCompactIntVecBuilder --> IntSliceView : view() (primary only)
PersistentBitVecBuilder --> PersistentBitVec : close() then open()
PersistentCompactIntVecBuilder --> PersistentCompactIntVec : close() then open()
```
### `PersistentBitVec` / `PersistentBitVecBuilder`
`PersistentBitVec` is the read-only type. `view()` returns a `BitSliceView<'_>` over the mmap word array. Direct inherent methods delegate to the view: `count_ones()`, `count_zeros()`, `partial_jaccard_dist(&Self)`, `jaccard_dist(&Self)`, `hamming_dist(&Self)`.
`BitIter<'a>` — exported iterator for `PersistentBitVec::iter()`:
```rust
pub struct BitIter<'a> { pub(crate) words: &'a [u64], pub(crate) slot: usize, pub(crate) n: usize }
```
`PersistentBitVecBuilder` is the read-write type. Mutation operations accept `BitSliceView<'_>`:
| Method | Cost |
|---|---|
| `set(slot, bool)` | O(1) |
| `view() -> BitSliceView<'_>` | O(1) |
| `or/and/xor(BitSliceView)` | word-level, O(n/64), SIMD-friendly |
| `not()` | `w ^= u64::MAX` per word, re-masks last word | O(n/64) |
| `copy_from(BitSliceView)` | `copy_from_slice` | O(n/64) |
### `PersistentCompactIntVec` / `PersistentCompactIntVecBuilder`
`PersistentCompactIntVec` is the read-only type. `view()` returns an `IntSliceView<'_>` over the mmap primary and overflow arrays. Inherent `iter()` is a merge scan (`Iter` struct). Inherent `sum()` and `count_nonzero()` use fast byte-scan helpers.
`PersistentCompactIntVecBuilder` is the read-write type. Mutation methods on the builder fall into two categories:
**Point mutations:**
| Method | Note |
|---|---|
| `set(slot, u32)` | writes primary[slot] or 255+overflow |
| `get(slot) -> u32` | reads primary byte or HashMap |
| `inc(slot)` | `get` + `set`, O(1) |
**Bulk computation methods** — accept view arguments:
| Method | Semantics | Overflow |
|---|---|---|
| `inc_present(BitSliceView)` | `+= 1` at each 1-bit | via `inc`, safe for any group size |
| `inc_present_fast(BitSliceView)` | same, raw u8 `+= 1` | `debug_assert` no 255 reached |
| `inc_predicate(IntSliceView, pred)` | `+= 1` where `pred(col[s])` | two-pass, safe |
| `inc_predicate_fast(IntSliceView, pred)` | same, raw u8 | `debug_assert` no 255 reached |
| `add(IntSliceView)` | `self[s] += other[s]` | primary fast path + overflow fallback |
| `min(IntSliceView)` | byte min + both-overflow fixup | see algorithm below |
| `max(IntSliceView)` | pre-pass + byte max | see algorithm below |
| `diff(IntSliceView)` | saturating sub | self<255 hot path |
| `mask_with(BitSliceView)` | zeros slots where mask bit = 0 | O(n_zeros) |
**`inc_present_fast` / `inc_predicate_fast` invariant:** caller guarantees no counter reaches 255 during the operation (group size < 255 for `inc_present_fast`, or chunk size < 255 for `inc_predicate_fast`). Violation is caught by `debug_assert` in dev builds.
**`min` algorithm:**
Exploits 255 = +∞: byte-level min is correct unless both sides are overflow.
```
snapshot self_ov: Vec<(slot,val)>
snapshot other_ov: HashMap<slot,val>
clear_overflow()
Pass 1 — byte min, SIMD-vectorizable, O(n)
Pass 2 — both-overflow fixup, O(k_self):
for (slot, self_val) in self_ov:
if slot ∈ other_ov: set(slot, min(self_val, other_ov[slot]))
```
**`max` algorithm:**
Cannot do byte max first — `max(255, b<255)=255` overwrites self's original overflow value. Pre-pass reads self's value at other's overflow slots before the byte pass.
```
Pre-pass O(k_other): for (slot, other_val) in other.overflow_entries():
set(slot, max(self.get(slot), other_val))
Pass 1 — byte max, SIMD-vectorizable, O(n)
```
---
## Matrix types
Four matrix types, two encodings × two formats:
| | Columnar format | Packed format |
|---|---|---|
| **Bit** | `PersistentBitMatrix` (Columnar variant) | `PersistentBitMatrix` (Packed variant) |
| **Int** | `PersistentCompactIntMatrix` (Columnar variant) | `PersistentCompactIntMatrix` (Packed variant) |
Both matrix types are enums (`Columnar` / `Packed` / `Implicit` for bit) behind a transparent API. `col_view(c)` returns the appropriate view directly:
```rust
// PersistentBitMatrix
pub fn col_view(&self, c: usize) -> BitSliceView<'_>
// PersistentCompactIntMatrix
pub fn col_view(&self, c: usize) -> IntSliceView<'_>
```
No wrapper enums (`BitColView`, `IntColView`): the caller receives a `Copy` view struct immediately usable with any view method or bulk builder method.
`pack_compact_int_matrix` and `pack_bit_matrix` convert columnar → packed format.
---
## Aggregation traits (matrix level)
### ColumnWeights
```rust
trait ColumnWeights: Send + Sync {
fn col_weights(&self) -> Array1<u64>; // sum per column
fn partial_kmer_counts(&self) -> Array1<u64>; // default = col_weights()
}
```
`partial_kmer_counts` is overridden for count matrices to return `count_nonzero` per column (distinct kmers) rather than total count.
### CountPartials
Abstract required methods: `partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`, `partial_relfreq_bray`, `partial_relfreq_euclidean`, `partial_hellinger`.
**Additivity rule:** self-contained partials (`partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`) can be element-wise summed across all `(partition, layer)` pairs. Normalised partials (`partial_relfreq_*`, `partial_hellinger`) require the **global** `col_weights` (accumulated across all layers and all partitions) as parameter.
**`partial_threshold_jaccard` returns `(inter, union)`** because `union[i,j]` depends on both columns simultaneously.
Provided finalisations:
| Finalisation | Formula |
|---|---|
| `bray_dist_matrix()` | `1 − 2·partial_bray[i,j] / (w[i] + w[j])` |
| `euclidean_dist_matrix()` | `√partial_euclidean[i,j]` |
| `threshold_jaccard_dist_matrix(t)` | `1 − inter[i,j] / union[i,j]` |
| `relfreq_bray_dist_matrix()` | `1 − partial_relfreq_bray[i,j]` |
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
### Mash distance
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
```
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
```
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
---
## Temp-file-backed types
**All inter-function results use temp-file-backed types** so the OS can page them out under memory pressure. This matters in practice: processing dozens of layers × hundreds of partitions in parallel would otherwise accumulate gigabytes of live anonymous memory.
### Lifecycle
```
TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
↓ (inc_present_fast / inc_predicate_fast / add / mask_with / …)
.freeze() → TempCompactIntVec (read-only mmap + TempDir)
↓ (optional)
.make_persistent(path) → PersistentCompactIntVec (permanent file)
```
Same pattern for `TempBitVecBuilder` → `TempBitVec` → `PersistentBitVec`.
**Drop order**: `TempCompactIntVec { vec: PersistentCompactIntVec, _temp: TempDir }` — Rust drops fields in declaration order. `vec` (mmap) released before `_temp` (directory deleted). No explicit `drop()` needed.
### TempCompactIntVec / TempCompactIntVecBuilder
```rust
pub struct TempCompactIntVec {
vec: PersistentCompactIntVec,
_temp: TempDir, // dropped after vec
}
pub(crate) struct TempCompactIntVecBuilder {
builder: PersistentCompactIntVecBuilder,
temp: TempDir,
}
```
`TempCompactIntVec`: read access via `get(slot)`, `sum()`, `iter()`, `view() -> IntSliceView<'_>`.
`TempCompactIntVecBuilder`: full delegation to inner `PersistentCompactIntVecBuilder` — all bulk computation methods (`inc_present_fast`, `inc_predicate_fast`, `add`, `min`, `max`, `diff`, `mask_with`) are exposed as `pub(crate)`.
### TempBitVec / TempBitVecBuilder
```rust
pub struct TempBitVec {
vec: PersistentBitVec,
_temp: TempDir,
}
pub(crate) struct TempBitVecBuilder {
builder: PersistentBitVecBuilder,
temp: TempDir,
}
```
`TempBitVec`: read access via `get(slot)`, `count_ones()`, `view() -> BitSliceView<'_>`, `iter()`.
`TempBitVecBuilder`: exposes `set(slot, bool)`, `or(BitSliceView)`, and:
```rust
pub(crate) fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool)
```
`or_where` — two passes, no intermediate allocation:
```
Pass 1 — primary bytes, O(n):
for slot in 0..n:
b = col.primary_bytes()[slot]
if b < 255 AND pred(b as u32): self.set(slot, true)
Pass 2 — overflow, O(k):
for (slot, val) in col.overflow_entries():
if pred(val): self.set(slot, true)
```
---
## Filter / Select API
### ColGroup
```rust
pub struct ColGroup { pub name: String, pub indices: Vec<usize> }
```
Defined **once at the index level** from column metadata. Valid in all matrices of all layers and partitions — column structure is identical across the entire hierarchy; only rows (kmer slots) are partitioned.
### Composition axis
- **Across partitions**: kmer space is partitioned → partial results **concatenated** (disjoint kmer ranges).
- **Across layers**: same kmer space, different counts → partial results **aggregated** (add, OR, etc.).
### MatrixGroupOps
Five required primitives + two default methods derived from them. All return temp-file-backed types.
```rust
pub trait MatrixGroupOps {
// required
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempCompactIntVec>;
fn partial_group_sum(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_any(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>;
fn partial_group_min(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_max(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
// defaults derived from partial_group_presence_count
fn partial_group_all(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == g.indices.len()
fn partial_group_none(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == 0
}
```
Implemented for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
For **bit matrices**: values are 0/1, so `partial_group_sum` = `partial_group_presence_count(g, 1)`; `partial_group_min` is AND (set first column then mask-with remaining); `partial_group_max` is OR via `partial_group_any` + `inc_present`.
**`partial_group_presence_count` — chunking for large groups:**
When `g.indices.len() < 255`: per-slot counts stay within `u8` range. Use `inc_present_fast` (bit) or `inc_predicate_fast(col_view(c), |v| v >= threshold)` (int) — raw u8 increment, no overflow entry written.
When `g.indices.len() ≥ 255`: process in chunks of 254 columns, accumulate via `.add(chunk_frozen.view())`.
**`partial_group_min` (int matrix)**: copy first column via `.add(col_view(first))` (start from 0 ⇒ copy), then `.min(col_view(c))` for remaining.
**`partial_group_max` (int matrix)**: `.max(col_view(c))` for all columns (start from 0 ⇒ first column acts as copy).
**`partial_group_any`** uses `or_where` on `TempBitVecBuilder` (two-pass: primary bytes then overflow entries).
**`partial_group_all` / `partial_group_none`** (default): call `partial_group_presence_count`, then iterate slots to produce the bit result. O(n) extra pass, not chunked.
### add_col_from — matrix builder integration
Both matrix builders accept temp-file results directly:
```rust
// PersistentBitMatrixBuilder
fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()>
fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> // nonzero → 1
// PersistentCompactIntMatrixBuilder
fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()>
fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> // bit → 0/1 u32
```
`add_col_from` copies the temp file to the matrix directory and increments `n_cols`; `close()` writes `meta.json` with the final column count. No separate `write_meta` step needed.
### mask_with
Direct method on `PersistentCompactIntVecBuilder` (and delegation via `TempCompactIntVecBuilder`). Zeros every slot where the corresponding mask bit is 0. Iterates only zero bits — O(n_zeros), O(1) when mask is all-ones.
```
for (w_idx, word) in mask.words():
if word == u64::MAX: continue // skip all-ones words
zeros = !word
while zeros != 0:
bit = trailing_zeros(zeros)
s = w_idx * 64 + bit
if primary[s] != 0: set(s, 0) // clears overflow entry too
zeros &= zeros − 1
```
Terminal operation for Filter (retain only selected kmer slots in a count vector) and Select (positional selection without MPHF).
+143
View File
@@ -0,0 +1,143 @@
# `obitaxonomy` — taxonomy concept paths
`obitaxonomy` is a dependency-free crate that defines a typed representation
of hierarchical concept paths (taxonomic or otherwise) stored in genome metadata.
---
## Concept path syntax
A concept path is stored as a metadata value with the prefix `taxonomy:/`:
```
taxonomy:/enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species
```
Structure:
- The `taxonomy:/` prefix is the type discriminator. Any metadata value starting
with it is parsed as a `TaxPath`; all others remain plain strings.
- The remainder is one or more `/`-separated segments.
- Each segment is `name` or `name@rank`, where `rank` is a label for the
taxonomic level (e.g. `family`, `genus`, `species`).
- Rank annotations are **optional per segment** and can be mixed freely.
- Spaces are allowed in both names and ranks.
### Reserved character
`@` is reserved throughout the taxonomy system and may **not** appear in:
| Context | Constraint |
|---------|------------|
| Segment name | forbidden |
| Rank/class label | forbidden |
| Metadata key names | forbidden (used as `key@rank` in predicate syntax) |
`@` is freely allowed in plain-text metadata values (non-taxonomy).
### Parse errors
| Condition | Error |
|-----------|-------|
| Value does not start with `taxonomy:/` | `MissingPrefix` |
| No segments after the prefix | `EmptyPath` |
| Segment with empty name (consecutive `/`) | `EmptySegmentName` |
| Segment with trailing `@` and no rank (`name@`) | `EmptyRankName` |
| Segment with more than one `@` | `AmbiguousRank` |
---
## Public API
### `TaxSegment`
A single node: a name and an optional rank.
```rust
seg.name() // &str
seg.rank() // Option<&str>
seg.to_string() // "name" or "name@rank"
TaxSegment::parse(s) // Result<TaxSegment, TaxError>
```
### `TaxPath`
```rust
TaxPath::parse(s) // Result<TaxPath, TaxError>
path.segments() // &[TaxSegment]
path.depth() // usize — number of segments
path.is_ancestor_of(&other) // bool — prefix match by name, ranks ignored
path.name_at_rank("genus") // Option<&str>
path.to_string() // reconstructs "taxonomy:/…"
```
`is_ancestor_of` compares segment **names** only — rank annotations are
informational and do not affect the ancestry relation.
```rust
let a: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus".parse()?;
let b: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species".parse()?;
assert!(a.is_ancestor_of(&b)); // true
assert!(b.is_ancestor_of(&a)); // false
assert!(a.is_ancestor_of(&a)); // true (equal ⇒ ancestor)
assert_eq!(b.name_at_rank("species"), Some("Escherichia coli"));
assert_eq!(b.name_at_rank("genus"), Some("Escherichia"));
assert_eq!(b.name_at_rank("order"), None);
```
---
## Integration with `GenomeInfo`
At index load time, every metadata value is inspected once:
- Starts with `taxonomy:/` → parsed into `TaxPath`, stored in `genome.taxonomy`.
- Otherwise → kept as-is in `genome.meta`.
```rust
struct GenomeInfo {
label: String,
meta: HashMap<String, String>, // plain text metadata
taxonomy: HashMap<String, TaxPath>, // parsed taxonomy metadata
}
```
The raw string is not duplicated. `TaxPath::to_string()` reconstructs the
original value losslessly for serialisation.
---
## Predicate operators (in `filter` / `select`)
Path predicates use the `~` / `!~` operators. The **stored value** always starts
with `/` (rooted path); the **query pattern** does not need to.
### Path pattern syntax
| Pattern | Semantics |
|---------|-----------|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B (start-anchored) |
| `A/B$` | value ends with A then B (end-anchored) |
| `/A/B$` | value is exactly A then B (fully anchored) |
| `A@x/B` | A with class `x` followed by B with any class |
| `A@x/B@y` | A with class `x` followed by B with class `y` |
A segment pattern without `@` matches the segment name regardless of its stored class.
### Rank-aware queries
```
key@rank=value
```
| Predicate form | Semantics |
|----------------|-----------|
| `key@rank=value` | genome's `key` has `value` at rank `rank` |
| `key@rank!=value` | does not |
| `key@rank=v1\|v2` | value at `rank` is `v1` or `v2` |
`~` combined with `@rank` on the key (e.g. `key@genus~pattern`) is not defined
and is rejected at parse time.
-188
View File
@@ -1,188 +0,0 @@
# Kmer filtering and ingroup/outgroup predicates
The `rebuild`, `dump`, and `unitig` commands all share the same filtering
system. Filters can select k-mers based on per-genome quorum counts, optionally
restricted to **ingroup** and **outgroup** genome sets derived from genome
metadata.
`rebuild` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical taxonomic paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
- **Absolute pattern** (starts with `/`): the value must start with the pattern
at a segment boundary.
`taxon~/Betulaceae/Betula` matches `/Betulaceae/Betula/nana` and
`/Betulaceae/Betula` but not `/Betulaceae/Betuloides/…`.
- **Bare segment** (no leading `/`): the value must contain the pattern as an
exact path component anywhere.
`taxon~Betula` matches any path that has `Betula` as one of its segments.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)` → `in_result`
2. Evaluate `OR(outgroup predicates)` → `out_result`
3. If `in_result = true` → **Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true` → **Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`rebuild` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`rebuild` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
Defaults: mins = 0 (no lower bound), max counts = group size, max fracs = 1.0
(no upper bound). A filter with all defaults is a no-op.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer rebuild src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer rebuild src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer rebuild src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer rebuild src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
The same flags work identically for `dump` and `unitig`. To dump only k-mers
specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `RebuildArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `rebuild`, `dump`, and `unitig` all go through this single
entry point.
+234
View File
@@ -0,0 +1,234 @@
# `select` — column projection and aggregation
`select` transforms an index by operating on its **genome columns**: projecting a
subset of columns, aggregating groups of genomes into synthetic columns, or both.
It is the column-axis counterpart of `filter` (row-axis operations).
Following relational algebra conventions:
| Command | Relational operation | Axis |
|----------|---------------------|----------|
| `filter` | σ — selection | rows (k-mers) |
| `select` | π — projection | columns (genomes) |
The two commands compose naturally: run `filter` first to restrict the kmer set,
then `select` to reshape the genome columns.
`select` never changes the kmer set. The MPHF and `unitigs.bin` of each layer
are preserved unchanged; only the data matrices are rewritten.
---
## Synopsis
```sh
obikmer select <input-index>
{ --output <dir> | --in-place }
[--group <name>:<pred> ...]
[--group-op <name>:<op> ...]
[--aggregate-by <key> ]
[--aggregate-op <op> ]
[--select <col1,col2,...> ]
[--presence-threshold <N> ]
```
---
## Output destination
Exactly one of `--output` or `--in-place` must be specified.
**`--output <dir>`** — writes a new index to `<dir>`. The source index is
unchanged. The MPHF and unitig files are copied; only the data matrices are
rewritten with the new column layout.
**`--in-place`** — rewrites the data matrices of the source index directly.
Removed or replaced columns are lost. The operation writes to temporary files
first, then renames atomically, so an interrupted run leaves the index intact.
---
## Defining output columns
### Named groups — `--group`
```
--group <name>:<pred>
```
Defines a named group of genomes using the same predicate syntax as `filter`.
Repeatable; a genome can belong to several groups.
```sh
--group "pub:species=Betula_pubescens"
--group "nan:species=Betula_nana"
```
### Per-group operator — `--group-op`
```
--group-op <name>:<op>
```
Assigns an aggregation operator to a named group. Optional; if absent, the
default operator applies (see below).
```sh
--group-op "pub:any"
--group-op "nan:all"
```
### Shorthand — `--aggregate-by` / `--aggregate-op`
`--aggregate-by <key>` automatically creates one group per unique value of the
metadata key `<key>`. Equivalent to one `--group <val>:<key>=<val>` per distinct
value. `--aggregate-op <op>` sets the operator for all auto-generated groups.
`--aggregate-by` and `--group` are mutually exclusive.
### Column selection and ordering — `--select`
```
--select col1,col2,...
```
Lists the output columns in order. Each element is either a group name (defined
by `--group` or generated by `--aggregate-by`) or a genome label from the source
index (pass-through, no aggregation).
**Default when `--select` is absent:**
all defined groups in declaration order (for `--group`), or all generated groups
in metadata-value order (for `--aggregate-by`). Individual genomes not in any
group are excluded unless named explicitly.
**When neither `--group` nor `--aggregate-by` is specified:**
`--select` can still reference genome labels for pure column projection (no
aggregation). If `--select` is also absent, all genomes are output unchanged
(identity transform — useful combined with row filtering via a prior `filter`
run).
---
## Aggregation operators
| Operator | Input | Output | Semantics |
|----------|-------------|----------|-----------|
| `any` | pres / count | presence | 1 if ≥ 1 genome in group carries the k-mer |
| `all` | pres / count | presence | 1 if every genome in group carries the k-mer |
| `none` | pres / count | presence | 1 if no genome in group carries the k-mer |
| `sum` | count | count | sum of counts across the group |
| `min` | count | count | minimum count |
| `max` | count | count | maximum count |
**Default operator:**
- Presence index: `any`
- Count index: `sum`
Logical operators (`any`/`all`/`none`) on a count index use
`--presence-threshold N` (default 0): a genome "carries" the k-mer if its count
is > N.
**Output index type:**
- If the source is a presence index, the output is always a presence index.
- If the source is a count index and every output column uses a logical operator
or is a pass-through from a presence source, the output is a presence index.
- Otherwise (at least one arithmetic operator on a count source), the output is
a count index.
---
## Behaviour for edge cases
| Situation | Behaviour |
|-----------|-----------|
| Genome missing the metadata key in `--aggregate-by` | genome ignored (no `NA` group) |
| Genome in multiple groups | contributes independently to each |
| `--group-op` references undefined group | error |
| `--select` element is neither group name nor genome label | error |
| `--output` and `--in-place` both specified | error |
| Neither `--output` nor `--in-place` | error |
| Group with zero matching genomes | column is all-zeros (or all-ones for `none`) |
---
## Examples
### Aggregate by metadata group, default operators
```sh
obikmer select myindex --output out --aggregate-by group
# one column per unique value of "group"; presence→any, count→sum
```
### Named groups with different operators
```sh
obikmer select myindex --output out \
--group "pub:species=Betula_pubescens" \
--group "nan:species=Betula_nana" \
--group-op "pub:any" \
--group-op "nan:all" \
--select "pub,nan"
```
### Mix aggregated group and individual genome
```sh
obikmer select myindex --output out \
--group "A:group=A" \
--select "A,Betula_nana--IGA-24-39"
```
### Pure column projection (no aggregation)
```sh
obikmer select myindex --output out \
--select "Betula_nana--TROM-V-149986,Betula_nana--AG-P04-25-01"
```
### In-place: keep only group A
```sh
obikmer select myindex --in-place --group "A:group=A" --select "A"
```
### Compose with filter
```sh
# Step 1: keep only B. nana-specific k-mers
obikmer filter myindex --output filtered \
--ingroup "species=Betula_nana" --outgroup "*"
# Step 2: aggregate genome columns by collection site
obikmer select filtered --output final --aggregate-by site
```
---
## Implementation notes
`select` does not rebuild the MPHF. The 256 partitions are processed in parallel
(rayon), each writing its output independently; results require no synchronisation
because every partition owns a distinct set of files.
For each layer in each partition:
1. The slot count `n` is read by opening the source data matrix.
2. A new data matrix is built with M columns (M = number of output columns).
3. For each slot `s` in `0..n`:
- `old_row = matrix.fill_row(s)` — reads the original `N`-column row without allocating.
- For each output column `j`:
- `new_row[j] = aggregate(op, old_row[group_indices])`.
- Pass-through columns are represented as single-element groups with the
default operator (`any` for presence, `sum` for count) — same code path.
- The new row is written slot by slot into each column builder.
4. All plain files in the source layer directory (`mphf.bin`, `unitigs.bin`,
evidence files, `layer_meta.json`) are copied verbatim; only the `presence/`
or `counts/` subdirectory is rewritten.
5. `index.meta` is rewritten with the new genome list and updated `with_counts`.
**`--in-place` write strategy:** new data is written to a temporary sibling
directory (`presence_new/` or `counts_new/`); on success the old directory is
removed and the temporary one is renamed into place. An interrupted run leaves
at most one stale `*_new/` directory; the original data is intact until the
rename step.
+5 -4
View File
@@ -9,12 +9,13 @@
| `superkmer` | Extract super-kmers from a sequence file and write to stdout |
| `index` | Build a complete genome index (scatter → dereplicate → count → layered MPHF) |
| `merge` | Merge multiple built indexes into one |
| `rebuild` | Filter and compact an existing index into a new single-layer index; supports ingroup/outgroup predicates on genome metadata |
| `filter` | Apply row-level selection (σ) to an index: retain only k-mers matching the ingroup/outgroup predicates. Output is a new single-layer index — compaction is a consequence, not the goal. Supports the shared [kmer filtering](implementation/filtering.md) system |
| `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the same ingroup/outgroup filtering as `rebuild` |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the same ingroup/outgroup filtering as `rebuild` |
| `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
| `reindex` | Convert an index's evidence in-place: exact ↔ approx |
| `utils` | Miscellaneous index utilities: `--new-label NEW=OLD` renames a genome label; `--upgrade-index` adds missing `layer_meta.json` to old indexes |
+84
View File
@@ -0,0 +1,84 @@
# Installation
## Prerequisites
### Rust toolchain
`obikmer` requires **Rust 1.85 or later** (edition 2024). Install or update via [rustup](https://rustup.rs):
```bash
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh
rustup update stable
```
### C build environment (required for hwloc)
`obikmer` embeds [hwloc](https://www.open-mpi.org/projects/hwloc/) (Hardware Locality) for NUMA-aware thread placement on multi-socket machines. hwloc is built from source at compile time via the `vendored` feature of the `hwlocality` crate. This requires a standard C build environment.
#### Linux (Debian/Ubuntu)
```bash
apt install build-essential automake libtool autoconf pkg-config
```
#### Linux (RHEL/Rocky/AlmaLinux)
```bash
dnf install gcc make automake libtool autoconf pkgconfig
```
#### HPC clusters
Most HPC clusters provide these tools via the module system:
```bash
module load gcc automake libtool autoconf
```
If in doubt, check whether `autoreconf --version` and `libtool --version` return successfully.
#### macOS
```bash
brew install automake libtool autoconf pkg-config
```
## Building
```bash
git clone <repository-url>
cd obikmer/src
cargo build --release
```
The compiled binary is at `target/release/obikmer`.
### Building on HPC clusters (network filesystems)
HPC home directories are typically on a network filesystem (Lustre, NFS) optimised for large sequential reads — not for the thousands of small file operations that Cargo generates during compilation. Building directly on such a filesystem can be extremely slow (0.1% CPU utilisation, tens of minutes for what should take seconds).
**Always redirect the build directory to a local scratch disk:**
```bash
CARGO_TARGET_DIR=/scratch/$USER/cargo-target cargo build --release
```
Adapt the path to the local scratch available on your cluster (`/var/tmp`, `/tmp`, `/scratch/local`, etc.). Once built, copy the binary to a permanent location:
```bash
cp /scratch/$USER/cargo-target/release/obikmer ~/bin/
```
## NUMA support
NUMA-aware thread placement is active automatically on multi-socket Linux machines (detected at runtime via hwloc). No special build flag is required — the detection is built in and falls back gracefully to the single-pool adaptive strategy on:
- macOS (Apple Silicon, unified memory)
- single-socket Linux machines
- any system where hwloc reports only one NUMA node
## Verifying the installation
```bash
obikmer --help
```
+18
View File
@@ -241,3 +241,21 @@
volume = 33,
year = 2017,
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
@misc{Mash-distances-doc,
author = {{Marbl Lab}},
howpublished = {Mash documentation},
title = {Mash Distance},
url = {https://mash.readthedocs.io/en/latest/distances.html},
urldate = {2026-07-09},
year = 2026}
@article{Fan2015-mash-formula,
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
doi = {10.1186/s12864-015-1647-5},
journal = {BMC Genomics},
number = 1,
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
url = {https://doi.org/10.1186/s12864-015-1647-5},
volume = 16,
year = 2015}
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes.
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$).
Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members:
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
This is a plain Shannon entropy over the observed raw-word frequencies.
## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG` ≡ `TGA` ≡ `GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.33–0.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy.
$H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base:
For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes.
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving:
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied.
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form.
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1)
- `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI
Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs` → `CommonArgs`) correspondent bien à ce qui est décrit.
File diff suppressed because it is too large Load Diff
+1
View File
@@ -2,3 +2,4 @@
- [Project domain](project_domain.md) — obikmer est pour la génomique (génomes individuels), pas la métagénomique
- [No architectural decisions without authorization](feedback_architectural_decisions.md) — toute décision architecturale (mémoire, algo, structure) requiert l'accord explicite de l'utilisateur avant toute action
- [Phases intra-partition parallèles](feedback_phases_parallelism.md) — graph build, compute_degrees, unitig traversal, MPHF utilisent Rayon — ne jamais les appeler "séquentielles"
+12
View File
@@ -0,0 +1,12 @@
---
name: feedback-phases-parallelism
description: Les phases intra-partition (graph build, compute_degrees, unitig traversal, MPHF) utilisent toutes Rayon — elles ne sont PAS séquentielles
metadata:
type: feedback
---
Ne jamais qualifier les phases intra-partition de "séquentielles". Chaque phase (graph build, compute_degrees, unitig traversal, MPHF build) utilise Rayon en interne et s'exécute en parallèle sur plusieurs cœurs.
**Why:** L'utilisateur a corrigé ce point plusieurs fois. Le décrire comme "séquentiel" est une erreur factuelle qui fausse l'analyse de performance.
**How to apply:** Quand on analyse l'efficacité CPU ou les 25% manquants, chercher la cause dans le déséquilibre de charge entre partitions, la contention Rayon entre workers, ou la latence inter-partitions — pas dans une prétendue sérialisation des phases.
+8 -1
View File
@@ -29,12 +29,14 @@ extra_javascript:
nav:
- Home: index.md
- Installation: installation.md
- Theory:
- Kmers and super-kmers: kmers.md
- DNA encoding: theory/encoding.md
- Entropy filter: theory/entropy.md
- Minimizer selection: theory/minimizer.md
- Partitioning architecture: theory/indexing.md
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
- Implementation:
- SuperKmer: implementation/superkmer.md
- Kmer: implementation/kmer.md
@@ -49,10 +51,15 @@ nav:
- PersistentCompactIntVec: implementation/persistent_compact_int_vec.md
- PersistentBitVec: implementation/persistent_bit_vec.md
- Merge command: implementation/merge.md
- Kmer filtering (rebuild/dump/unitig): implementation/rebuild_filter.md
- Merge parallelism & memory: implementation/merge_parallelism.md
- Kmer filtering: implementation/filtering.md
- Select command: implementation/select.md
- obitaxonomy crate: implementation/obitaxonomy.md
- Architecture:
- Sequences: architecture/sequences/invariant.md
- Kmer index: architecture/index_architecture.md
- NUMA-aware worker pools: architecture/numa_worker_pools.md
- NUMA-aware partition runner: architecture/numa_partition_runner.md
watch:
- docmd
+44
View File
@@ -0,0 +1,44 @@
# La crate obicompactvector
Le code actuelle est ce qu'il est. Ce n'est pad la vrérité absolue, c'est un premier effort d'implémentation rien de plus. Ci-dessous je vais décrire les objectif et la structure qui devrait être. LA VERITE A ATTEINDRE.
La crate fournie des représentations les plus compact possible en mémoire de matrice de comptage ou de présence de k-mer dans des génomes. Chaque colonne représente un génome chaque ligne un kmer. une matrice est une collection de vecteur ou chacun des vecteur est un colonne de la matrice.
Les matrices comme les colonnes ont vocation à être persistante. Les données sont stockées dans des fichiers binaires. Les données sont mappées en mémoire via `mmap`
Les structure sont par essence immutables. Il existe des représentations mutables des colonnes qui permettent leur construction. À la fin de leur construction, les colonnes sont fermée ce qui les rends immutable.
Les matrices peuvent êtres représenté de deux façons:
- via un répertoire contenant une collection de fichier colonnes
- via un fichier matrix qui est la concatenation de plusieurs fichiers colonnes.
## Les matrices de comptage
Ce sont des matrice d'entiers positif la plus part du temps de petites valeurs (inferieurs à 255). On assume que toutes les valeurs sont représentables sur un `u32`
## Les matrices de presence
Ce sont des matrices de boolean représenté comme des champs de bits
Il existe une forme implicite des vecteur de présence, qui n'est représenté par aucun fichier pour lequel toutes les valeurs sont vraies
## représentation légère des colonnes
Les colonnes qu'elles soient de unitiaire (fichier colonne) ou partie d'un fichier composite matrice peuvent être représenté par un objet léger donnant acces à ces valeurs ainsi qu'à la longeur du vecteurs. Toutes les méthodes de calcules doivent uniquement travailler à partir de ces représentations légère unifiées des colonnes.
### Représentation légère d'un vecteur de présence
Le vecteur est représenté par
- un champs de bits encodé comme un [u64]
- un usize encodant la longeur du champs de bits
### Représentation légère d'un vecteur de présence
Le vecteur est représenté par
- un vecteur [u8] encodant directement les valeur faibe du vecteur [0,255[
La valeur 255 est une valeur sentinelle indiquant que la valeure vraie est >=255
et se trouvent dans une structure d'overflow
- un iterateur de (usize,u32) listant les valeurs d'overflow coorespondant aux valeurs
sentinels (255) du [u8]
- un usize encodant la longeur du champs de bits
+347
View File
@@ -0,0 +1,347 @@
#!/usr/bin/env python3
"""Parse obikmer merge debug log → Markdown performance report."""
import re
import sys
from datetime import datetime
from collections import defaultdict
from statistics import mean, median, stdev
ANSI = re.compile(r'\x1b\[[0-9;]*m')
def strip(s):
return ANSI.sub('', s)
def parse_ts(s):
return datetime.fromisoformat(s.replace('Z', '+00:00'))
def dur_s(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1e3
if s.endswith('µs'): return float(s[:-2]) / 1e6
if s.endswith('us'): return float(s[:-2]) / 1e6
if s.endswith('ns'): return float(s[:-2]) / 1e9
if s.endswith('s'): return float(s[:-1])
return float(s)
def fmt_s(s):
if s < 0.001: return f"{s*1e6:.0f}µs"
if s < 1: return f"{s*1e3:.0f}ms"
if s < 60: return f"{s:.2f}s"
return f"{s/60:.1f}min ({s:.0f}s)"
def fmt_rate(n, s):
if s <= 0: return "—"
r = n / s
if r >= 1e9: return f"{r/1e9:.2f}G/s"
if r >= 1e6: return f"{r/1e6:.2f}M/s"
if r >= 1e3: return f"{r/1e3:.2f}K/s"
return f"{r:.0f}/s"
def pct(a, b):
return f"{100*a/b:.1f}%" if b else "—"
def stats_row(label, values, unit="s", fmt=fmt_s):
if not values: return f"| {label} | — | — | — | — | — |"
mn, mx, med, av = min(values), max(values), median(values), mean(values)
sd = stdev(values) if len(values) > 1 else 0
return f"| {label} | {fmt(mn)} | {fmt(med)} | {fmt(av)} | {fmt(mx)} | {fmt(sd)} |"
# ── patterns ──────────────────────────────────────────────────────────────────
TS = r'(\d{4}-\d{2}-\d{2}T[\d:.]+Z)'
pats = {
'graph_done': re.compile(TS + r'.*partition (\d+): de Bruijn graph done — (\d+) new kmers'),
'trav_start': re.compile(TS + r'.*partition (\d+): unitig traversal start — (\d+) nodes'),
'trav_closing': re.compile(TS + r'.*partition (\d+): unitig writer closing'),
'trav_closed': re.compile(TS + r'.*partition (\d+): unitig writer closed'),
'graph_dropped': re.compile(TS + r'.*partition (\d+): graph dropped — starting MPHF build \((\d+) unitigs\)'),
'mphf_done': re.compile(TS + r'.*partition (\d+): MPHF build done'),
'mphf_open': re.compile(TS + r'.*partition (\d+): MPHF open in ([\d.]+)s'),
'bld_ready': re.compile(TS + r'.*partition (\d+): builders ready in ([\d.]+)s'),
'pass2_done': re.compile(TS + r'.*partition (\d+): pass2 pipeline done in ([\d.]+)s'),
'bld_closed': re.compile(TS + r'.*partition (\d+): builders closed in ([\d.]+)s'),
'part_done': re.compile(TS + r'.*partition (\d+): done in ([\d.]+)s — (\d+) new kmers'),
'worker': re.compile(TS + r'.*activated worker (\d+).*efficiency (\d+)%.*gain vs prev (\d+)%'),
'worker_poll': re.compile(TS + r'.*activated worker (\d+) \(poll\).*efficiency (\d+)%'),
'compute_deg': re.compile(TS + r'.*partition (\d+): compute_degrees in ([\d.]+)s — (\d+) nodes'),
'stage_done': re.compile(TS + r'.*done stage=merge_partitions wall_secs=([\d.]+)'),
'workers_rep': re.compile(r'workers spawned: (\d+) / (\d+)'),
}
# ── parse ─────────────────────────────────────────────────────────────────────
P = defaultdict(dict) # partition_id → timing dict
workers_ev = []
wall_total = None
workers_final = (None, None)
with open(sys.argv[1]) as f:
for raw in f:
line = strip(raw)
m = pats['graph_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['n_kmers'] = int(m.group(3))
P[pid]['graph_done_ts'] = parse_ts(m.group(1))
continue
m = pats['trav_start'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_start_ts'] = parse_ts(m.group(1))
P[pid]['n_nodes'] = int(m.group(3))
continue
m = pats['trav_closing'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_closing_ts'] = parse_ts(m.group(1))
continue
m = pats['trav_closed'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_closed_ts'] = parse_ts(m.group(1))
continue
m = pats['graph_dropped'].search(line)
if m:
pid = int(m.group(2))
P[pid]['drop_ts'] = parse_ts(m.group(1))
P[pid]['n_unitigs'] = int(m.group(3))
continue
m = pats['mphf_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['mphf_done_ts'] = parse_ts(m.group(1))
continue
m = pats['mphf_open'].search(line)
if m:
pid = int(m.group(2))
P[pid]['mphf_open_s'] = float(m.group(3))
continue
m = pats['bld_ready'].search(line)
if m:
pid = int(m.group(2))
P[pid]['bld_ready_s'] = float(m.group(3))
continue
m = pats['pass2_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['pass2_s'] = float(m.group(3))
continue
m = pats['bld_closed'].search(line)
if m:
pid = int(m.group(2))
P[pid]['bld_closed_s'] = float(m.group(3))
continue
m = pats['part_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['total_s'] = float(m.group(3))
P[pid]['done_ts'] = parse_ts(m.group(1))
continue
m = pats['worker'].search(line)
if m:
workers_ev.append({'n': int(m.group(2)), 'eff': int(m.group(3)),
'gain': int(m.group(4)), 'ts': parse_ts(m.group(1)), 'poll': False})
continue
m = pats['worker_poll'].search(line)
if m:
workers_ev.append({'n': int(m.group(2)), 'eff': int(m.group(3)),
'gain': None, 'ts': parse_ts(m.group(1)), 'poll': True})
continue
m = pats['compute_deg'].search(line)
if m:
pid = int(m.group(2))
P[pid]['cdeg_s'] = float(m.group(3))
P[pid]['n_nodes'] = P[pid].get('n_nodes') or int(m.group(4))
continue
m = pats['stage_done'].search(line)
if m:
wall_total = float(m.group(2))
continue
m = pats['workers_rep'].search(line)
if m:
workers_final = (int(m.group(1)), int(m.group(2)))
continue
# ── derive per-partition phases ───────────────────────────────────────────────
def tsdiff(p, k1, k2):
if k1 in p and k2 in p:
return (p[k2] - p[k1]).total_seconds()
return None
phases = {}
for pid, p in P.items():
row = {'pid': pid}
row['n_kmers'] = p.get('n_kmers', 0)
row['n_nodes'] = p.get('n_nodes', 0)
row['n_unitigs']= p.get('n_unitigs', 0)
row['total_s'] = p.get('total_s')
row['cdeg_s'] = p.get('cdeg_s')
row['mphf_open_s'] = p.get('mphf_open_s')
row['bld_ready_s'] = p.get('bld_ready_s')
row['pass2_s'] = p.get('pass2_s')
row['bld_closed_s'] = p.get('bld_closed_s')
# Traversal: trav_start → trav_closing (= writing all unitigs)
row['trav_s'] = tsdiff(p, 'trav_start_ts', 'trav_closing_ts')
# Writer close: trav_closing → trav_closed
row['close_s'] = tsdiff(p, 'trav_closing_ts', 'trav_closed_ts')
# Graph drop: trav_closed → drop_ts
row['drop_s'] = tsdiff(p, 'trav_closed_ts', 'drop_ts')
# MPHF build: drop_ts → mphf_done_ts
row['mphf_s'] = tsdiff(p, 'drop_ts', 'mphf_done_ts')
# After MPHF: mphf_done → done_ts
row['post_s'] = tsdiff(p, 'mphf_done_ts', 'done_ts')
# Graph build: total - known phases (rough estimate)
known = sum(v for v in [row['cdeg_s'], row['trav_s'], row['close_s'], row['drop_s'],
row['mphf_s'], row['mphf_open_s'], row['bld_ready_s'],
row['pass2_s'], row['bld_closed_s']] if v is not None)
row['graph_build_s'] = (row['total_s'] - known) if row['total_s'] else None
phases[pid] = row
# helpers
def collect(key):
return [r[key] for r in phases.values() if r.get(key) is not None]
def rate_stats(n_key, t_key):
"""Returns list of throughput values (items/s)."""
result = []
for r in phases.values():
n, t = r.get(n_key), r.get(t_key)
if n and t and t > 0:
result.append(n / t)
return result
# ── output ────────────────────────────────────────────────────────────────────
out = []
w = out.append
w("# obikmer merge — performance report\n")
# Run info
n_parts = len([r for r in phases.values() if r['n_kmers'] > 0])
n_empty = len([r for r in phases.values() if r['n_kmers'] == 0])
total_kmers = sum(r['n_kmers'] for r in phases.values())
w("## Run summary\n")
w(f"- **Partitions**: {len(phases)} total — {n_parts} non-empty, {n_empty} empty")
w(f"- **New kmers (total)**: {total_kmers:,}")
if wall_total:
w(f"- **merge_partitions wall time**: {fmt_s(wall_total)}")
if workers_final[0]:
w(f"- **Workers spawned**: {workers_final[0]} / {workers_final[1]} (max)")
w("")
# Worker spawn timeline
if workers_ev:
w("## Worker activation\n")
w("| Time | Worker # | Trigger | Efficiency | Gain vs prev |")
w("|------|----------|---------|------------|--------------|")
t0 = workers_ev[0]['ts']
for e in workers_ev:
elapsed = fmt_s((e['ts'] - t0).total_seconds())
trigger = "poll (timeout)" if e['poll'] else "partition done"
gain = f"{e['gain']}%" if e.get('gain') is not None else "—"
w(f"| +{elapsed} | {e['n']} | {trigger} | {e['eff']}% | {gain} |")
w("")
# Phase breakdown table
w("## Phase timing statistics\n")
w("Columns: min | median | mean | max | stdev\n")
w("| Phase | min | median | mean | max | stdev |")
w("|-------|-----|--------|------|-----|-------|")
w(stats_row("Graph build (estimated)", collect('graph_build_s')))
w(stats_row("compute_degrees", collect('cdeg_s')))
w(stats_row("Unitig traversal", collect('trav_s')))
w(stats_row("Writer close (uw.close)", collect('close_s')))
w(stats_row("Graph drop", collect('drop_s')))
w(stats_row("MPHF build", collect('mphf_s')))
w(stats_row("MPHF open", collect('mphf_open_s')))
w(stats_row("Builders ready", collect('bld_ready_s')))
w(stats_row("Pass2 pipeline", collect('pass2_s')))
w(stats_row("Builders close", collect('bld_closed_s')))
w(stats_row("Post-MPHF (residual)", collect('post_s')))
w(stats_row("**Total per partition**", collect('total_s')))
w("")
# Throughput
w("## Throughput by phase\n")
w("| Phase | metric | min | median | mean | max |")
w("|-------|--------|-----|--------|------|-----|")
def rate_row(label, rates):
if not rates: return f"| {label} | — | — | — | — | — |"
f = lambda x: fmt_rate(x, 1)
mn, med, av, mx = min(rates), median(rates), mean(rates), max(rates)
return f"| {label} | nodes/s | {f(mn)} | {f(med)} | {f(av)} | {f(mx)} |"
w(rate_row("compute_degrees", rate_stats('n_nodes', 'cdeg_s')))
w(rate_row("Unitig traversal", rate_stats('n_nodes', 'trav_s')))
w(rate_row("MPHF build", rate_stats('n_unitigs', 'mphf_s')))
w("")
# Top 10 slowest partitions
w("## Top 10 slowest partitions\n")
w("| Partition | nodes | unitigs | total | trav | MPHF | graph build |")
w("|-----------|-------|---------|-------|------|------|-------------|")
sorted_parts = sorted(phases.values(), key=lambda r: r['total_s'] or 0, reverse=True)
for r in sorted_parts[:10]:
pid = r['pid']
def f(k): return fmt_s(r[k]) if r.get(k) is not None else "—"
nodes = f"{r['n_nodes']/1e6:.1f}M" if r['n_nodes'] else "—"
unitigs = f"{r['n_unitigs']/1e6:.1f}M" if r['n_unitigs'] else "—"
w(f"| {pid} | {nodes} | {unitigs} | {f('total_s')} | {f('trav_s')} | {f('mphf_s')} | {f('graph_build_s')} |")
w("")
# Phase share of total time (for non-empty partitions with full data)
complete = [r for r in phases.values()
if all(r.get(k) is not None
for k in ('total_s','trav_s','close_s','drop_s','mphf_s',
'mphf_open_s','bld_ready_s','pass2_s','bld_closed_s'))
and r['total_s'] and r['total_s'] > 0]
if complete:
w("## Phase share of total time (mean across complete partitions)\n")
total_mean = mean(r['total_s'] for r in complete)
w(f"_Based on {len(complete)} partitions with full timing data. Mean total: {fmt_s(total_mean)}_\n")
w("| Phase | mean time | share |")
w("|-------|-----------|-------|")
for label, key in [
("Graph build", 'graph_build_s'),
("compute_degrees", 'cdeg_s'),
("Unitig traversal", 'trav_s'),
("Writer close", 'close_s'),
("Graph drop", 'drop_s'),
("MPHF build", 'mphf_s'),
("MPHF open", 'mphf_open_s'),
("Builders ready", 'bld_ready_s'),
("Pass2 pipeline", 'pass2_s'),
("Builders close", 'bld_closed_s'),
("Post-MPHF (residual)", 'post_s'),
]:
vals = [r[key] for r in complete]
m = mean(vals)
w(f"| {label} | {fmt_s(m)} | {pct(m, total_mean)} |")
w("")
print('\n'.join(out))
+323 -6
View File
@@ -128,6 +128,12 @@ version = "0.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "2ad8689a486416c401ea15715a4694de30054248ec627edbf31f49cb64ee4086"
[[package]]
name = "arrayvec"
version = "0.7.6"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "7c02d123df017efcdfbd739ef81735b36c5ba83ec3c59c80a9d7ecc718f92e50"
[[package]]
name = "as-slice"
version = "0.2.1"
@@ -143,6 +149,15 @@ version = "1.5.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c08606f8c3cbf4ce6ec8e28fb0014a2c086708fe954eaa885384a6165172e7e8"
[[package]]
name = "autotools"
version = "0.2.7"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ef941527c41b0fc0dd48511a8154cd5fc7e29200a0ff8b7203c5d777dbc795cf"
dependencies = [
"cc",
]
[[package]]
name = "backtrace"
version = "0.3.76"
@@ -224,6 +239,15 @@ dependencies = [
"generic-array",
]
[[package]]
name = "block-buffer"
version = "0.12.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "d2f6c7dbe95a6ed67ad9f18e57daf93a2f034c524b99fd2b76d18fdfeb6660aa"
dependencies = [
"hybrid-array",
]
[[package]]
name = "block-pseudorand"
version = "0.1.2"
@@ -415,6 +439,15 @@ version = "1.1.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c8d4a3bb8b1e0c1050499d1815f5ab16d04f0959b233085fb31653fbfc9d98f9"
[[package]]
name = "cmake"
version = "0.1.58"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c0f78a02292a74a88ac736019ab962ece0bc380e3f977bf72e376c5d78ff0678"
dependencies = [
"cc",
]
[[package]]
name = "colorchoice"
version = "1.0.5"
@@ -464,6 +497,21 @@ dependencies = [
"windows-sys 0.59.0",
]
[[package]]
name = "const-oid"
version = "0.10.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "a6ef517f0926dd24a1582492c791b6a4818a4d94e789a334894aa15b0d12f55c"
[[package]]
name = "convert_case"
version = "0.10.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "633458d4ef8c78b72454de2d54fd6ab2e60f9e02be22f3c6104cdc8a4e0fceb9"
dependencies = [
"unicode-segmentation",
]
[[package]]
name = "core-foundation-sys"
version = "0.8.7"
@@ -488,6 +536,15 @@ dependencies = [
"libc",
]
[[package]]
name = "cpufeatures"
version = "0.3.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "8b2a41393f66f16b0823bb79094d54ac5fbd34ab292ddafb9a0456ac9f87d201"
dependencies = [
"libc",
]
[[package]]
name = "crc32fast"
version = "1.5.0"
@@ -601,6 +658,15 @@ dependencies = [
"typenum",
]
[[package]]
name = "crypto-common"
version = "0.2.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ce6e4c961d6cd6c9a86db418387425e8bdeaf05b3c8bc1411e6dca4c252f1453"
dependencies = [
"hybrid-array",
]
[[package]]
name = "csv"
version = "1.4.0"
@@ -640,14 +706,48 @@ dependencies = [
"uuid",
]
[[package]]
name = "derive_more"
version = "2.1.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "d751e9e49156b02b44f9c1815bcb94b984cdcc4396ecc32521c739452808b134"
dependencies = [
"derive_more-impl",
]
[[package]]
name = "derive_more-impl"
version = "2.1.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "799a97264921d8623a957f6c3b9011f3b5492f557bbb7a5a19b7fa6d06ba8dcb"
dependencies = [
"convert_case",
"proc-macro2",
"quote",
"rustc_version",
"syn",
"unicode-xid",
]
[[package]]
name = "digest"
version = "0.10.7"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9ed9a281f7bc9b7576e61468ba615a66a5c8cfdff42420a70aa82701a3b1e292"
dependencies = [
"block-buffer",
"crypto-common",
"block-buffer 0.10.4",
"crypto-common 0.1.7",
]
[[package]]
name = "digest"
version = "0.11.3"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "f1dd6dbb5841937940781866fa1281a1ff7bd3bf827091440879f9994983d5c2"
dependencies = [
"block-buffer 0.12.1",
"const-oid",
"crypto-common 0.2.2",
]
[[package]]
@@ -742,6 +842,16 @@ version = "2.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9f1f227452a390804cdb637b74a86990f2a7d7ba4b7d5693aac9b4dd6defd8d6"
[[package]]
name = "filetime"
version = "0.2.29"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "5c287a33c7f0a620c38e641e7f60827713987b3c0f26e8ddc9462cc69cf75759"
dependencies = [
"cfg-if",
"libc",
]
[[package]]
name = "find-msvc-tools"
version = "0.1.9"
@@ -916,6 +1026,65 @@ version = "0.5.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "fc0fef456e4baa96da950455cd02c081ca953b141298e41db3fc7e36b1da849c"
[[package]]
name = "http"
version = "1.4.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "6970f50e31d6fc17d3fa27329444bfa74e196cf62e95052a3f6fee181dba6425"
dependencies = [
"bytes",
"itoa",
]
[[package]]
name = "httparse"
version = "1.10.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "6dbf3de79e51f3d586ab4cb9d5c3e2c14aa28ed23d180cf89b4df0454a69cc87"
[[package]]
name = "hwlocality"
version = "1.0.0-alpha.12"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "4c2e65a48d3b300843ac84a2fe8e166bb5a5b00f30054593bcee8157e4b465fd"
dependencies = [
"arrayvec",
"bitflags 2.11.1",
"derive_more",
"errno",
"hwlocality-sys",
"libc",
"strum",
"thiserror 2.0.18",
"windows-sys 0.61.2",
]
[[package]]
name = "hwlocality-sys"
version = "0.7.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "10a83c43a772c1f774b806deb44891c2a9578eb33cec48aad513482e0da3d4d4"
dependencies = [
"autotools",
"cmake",
"flate2",
"libc",
"pkg-config",
"sha3",
"tar",
"ureq 3.3.0",
"windows-sys 0.61.2",
]
[[package]]
name = "hybrid-array"
version = "0.4.12"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9155a582abd142abc056962c29e3ce5ff2ad5469f4246b537ed42c5deba857da"
dependencies = [
"typenum",
]
[[package]]
name = "icu_collections"
version = "2.2.0"
@@ -1145,6 +1314,16 @@ dependencies = [
"wasm-bindgen",
]
[[package]]
name = "keccak"
version = "0.2.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9e24a010dd405bd7ed803e5253182815b41bf2e6a80cc3bfc066658e03a198aa"
dependencies = [
"cfg-if",
"cpufeatures 0.3.0",
]
[[package]]
name = "kodama"
version = "0.2.3"
@@ -1486,6 +1665,7 @@ name = "obidebruinj"
version = "0.1.0"
dependencies = [
"ahash",
"crossbeam-channel",
"hashbrown 0.14.5",
"obifastwrite",
"obikseq",
@@ -1502,27 +1682,41 @@ dependencies = [
"xxhash-rust",
]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]]
name = "obikindex"
version = "0.1.0"
dependencies = [
"crossbeam-channel",
"hwlocality",
"indicatif",
"ndarray",
"obicompactvec",
"obikpartitionner",
"obikseq",
"obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio",
"obisys",
"rayon",
"serde",
"serde_json",
"tempfile",
"tracing",
"tracing-subscriber",
]
[[package]]
name = "obikmer"
version = "0.1.0"
version = "1.1.44"
dependencies = [
"clap",
"csv",
@@ -1540,6 +1734,7 @@ dependencies = [
"obiskbuilder",
"obiskio",
"obisys",
"obitaxonomy",
"pprof",
"rayon",
"serde_json",
@@ -1559,9 +1754,11 @@ dependencies = [
"niffler 3.0.0",
"obicompactvec",
"obidebruinj",
"obikentropy",
"obikrope",
"obikseq",
"obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio",
@@ -1633,14 +1830,16 @@ dependencies = [
"regex",
"tracing",
"tracing-subscriber",
"ureq",
"ureq 2.12.1",
]
[[package]]
name = "obiskbuilder"
version = "0.1.0"
dependencies = [
"criterion2",
"lazy_static",
"obikentropy",
"obikrope",
"obikseq",
"obiread",
@@ -1670,6 +1869,10 @@ dependencies = [
"tracing",
]
[[package]]
name = "obitaxonomy"
version = "0.1.0"
[[package]]
name = "object"
version = "0.37.3"
@@ -2174,6 +2377,15 @@ version = "2.1.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "94300abf3f1ae2e2b8ffb7b58043de3d399c73fa6f4b73826402a5c457614dbe"
[[package]]
name = "rustc_version"
version = "0.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "cfcb3a22ef46e85b45de6ee7e79d063319ebb6594faafcf1c225ea92ab6e9b92"
dependencies = [
"semver",
]
[[package]]
name = "rustix"
version = "1.1.4"
@@ -2260,6 +2472,12 @@ dependencies = [
"syn",
]
[[package]]
name = "semver"
version = "1.0.28"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "8a7852d02fc848982e0c167ef163aaff9cd91dc640ba85e263cb1ce46fae51cd"
[[package]]
name = "serde"
version = "1.0.228"
@@ -2310,8 +2528,18 @@ source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "a7507d819769d01a365ab707794a4084392c824f54a7a6a7862f8c3d0892b283"
dependencies = [
"cfg-if",
"cpufeatures",
"digest",
"cpufeatures 0.2.17",
"digest 0.10.7",
]
[[package]]
name = "sha3"
version = "0.11.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "be176f1a57ce4e3d31c1a166222d9768de5954f811601fb7ca06fc8203905ce1"
dependencies = [
"digest 0.11.3",
"keccak",
]
[[package]]
@@ -2372,6 +2600,27 @@ version = "0.11.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "7da8b5736845d9f2fcb837ea5d9e2628564b3b043a70948a3f0b778838c5fb4f"
[[package]]
name = "strum"
version = "0.28.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9628de9b8791db39ceda2b119bbe13134770b56c138ec1d3af810d045c04f9bd"
dependencies = [
"strum_macros",
]
[[package]]
name = "strum_macros"
version = "0.28.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ab85eea0270ee17587ed4156089e10b9e6880ee688791d45a905f5b1ca36f664"
dependencies = [
"heck",
"proc-macro2",
"quote",
"syn",
]
[[package]]
name = "subtle"
version = "2.6.1"
@@ -2467,6 +2716,17 @@ version = "1.0.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "55937e1799185b12863d447f42597ed69d9928686b8d88a1df17376a097d8369"
[[package]]
name = "tar"
version = "0.4.46"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "3f6221d9a6003c78398e3b239969f352578258df48c8eb051caadae0015bc840"
dependencies = [
"filetime",
"libc",
"xattr",
]
[[package]]
name = "tempfile"
version = "3.27.0"
@@ -2642,12 +2902,24 @@ version = "1.0.24"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "e6e4313cd5fcd3dad5cafa179702e2b244f760991f45397d14d4ebf38247da75"
[[package]]
name = "unicode-segmentation"
version = "1.13.3"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c6f5d3c3b1bf09027a88a6bc961fc00497d651009560b5463668dc81b0fa87a8"
[[package]]
name = "unicode-width"
version = "0.2.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "b4ac048d71ede7ee76d585517add45da530660ef4390e49b098733c6e897f254"
[[package]]
name = "unicode-xid"
version = "0.2.6"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ebc1c04c71510c7f702b52b7c350734c9ff1295c464a03335b00bb84fc54f853"
[[package]]
name = "untrusted"
version = "0.9.0"
@@ -2670,6 +2942,35 @@ dependencies = [
"webpki-roots 0.26.11",
]
[[package]]
name = "ureq"
version = "3.3.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "dea7109cdcd5864d4eeb1b58a1648dc9bf520360d7af16ec26d0a9354bafcfc0"
dependencies = [
"base64",
"flate2",
"log",
"percent-encoding",
"rustls",
"rustls-pki-types",
"ureq-proto",
"utf8-zero",
"webpki-roots 1.0.7",
]
[[package]]
name = "ureq-proto"
version = "0.6.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "e994ba84b0bd1b1b0cf92878b7ef898a5c1760108fe7b6010327e274917a808c"
dependencies = [
"base64",
"http",
"httparse",
"log",
]
[[package]]
name = "url"
version = "2.5.8"
@@ -2682,6 +2983,12 @@ dependencies = [
"serde",
]
[[package]]
name = "utf8-zero"
version = "0.8.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "b8c0a043c9540bae7c578c88f91dda8bd82e59ae27c21baca69c8b191aaf5a6e"
[[package]]
name = "utf8_iter"
version = "1.0.4"
@@ -3107,6 +3414,16 @@ dependencies = [
"tap",
]
[[package]]
name = "xattr"
version = "1.6.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "32e45ad4206f6d2479085147f02bc2ef834ac85886624a23575ae137c8aa8156"
dependencies = [
"libc",
"rustix",
]
[[package]]
name = "xxhash-rust"
version = "0.8.15"
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace]
resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex"]
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release]
debug = 1
BIN
View File
Binary file not shown.
+1 -1
View File
@@ -7,6 +7,6 @@ edition = "2024"
memmap2 = "0.9"
ndarray = "0.16"
rayon = "1"
tempfile = "3"
[dev-dependencies]
tempfile = "3"
+243 -106
View File
@@ -1,5 +1,5 @@
use std::fs::{self, File};
use std::io::{self, Write as _};
use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
@@ -7,8 +7,12 @@ use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::layer_meta::LayerMeta;
use crate::meta::MatrixMeta;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use crate::views::BitSliceView;
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pbiv"))
@@ -54,34 +58,11 @@ impl ColumnarBitMatrix {
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols();
let results: Vec<(usize, usize, u64, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| {
let (inter, union) = self.col(i).partial_jaccard_dist(self.col(j));
(i, j, inter, union)
})
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_jaccard_dist(self.col(j)))
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.col(i).hamming_dist(self.col(j)))
}
fn pairwise_u64(&self, f: impl Fn(usize, usize) -> u64 + Sync) -> Array2<u64> {
let n = self.n_cols();
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| (i, j, f(i, j)))
.collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
pairwise_matrix(self.n_cols(), |i, j| self.col(i).hamming_dist(self.col(j)))
}
pub(crate) fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
@@ -147,113 +128,116 @@ impl PackedBitMatrix {
}).collect()
}
#[inline]
fn col_bytes(&self, c: usize) -> &[u8] {
let start = self.data_offsets[c];
let len = (self.n_rows + 7) / 8;
&self.mmap[start..start + len]
&self.mmap[start..start + self.n_rows.div_ceil(8)]
}
fn count_ones_col(&self, c: usize) -> u64 {
let bytes = self.col_bytes(c);
let full = self.n_rows / 8;
let rem = self.n_rows % 8;
let mut n: u64 = bytes[..full].iter().map(|b| b.count_ones() as u64).sum();
if rem > 0 { n += (bytes[full] & ((1u8 << rem) - 1)).count_ones() as u64; }
n
fn col_words(&self, c: usize) -> &[u64] {
let nw = self.n_rows.div_ceil(64);
// SAFETY: data_offsets[c] is always 8-byte aligned.
// PBMX header = 24 + n_cols×8 (multiple of 8); each PBIV blob =
// 16 + nwords×8 (multiple of 8); mmap base is page-aligned.
let ptr = self.mmap[self.data_offsets[c]..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
fn pair_op(&self, i: usize, j: usize, and_or: bool) -> u64 {
let ai = self.col_bytes(i);
let aj = self.col_bytes(j);
let full = self.n_rows / 8;
let rem = self.n_rows % 8;
let mut n: u64 = ai[..full].iter().zip(aj[..full].iter())
.map(|(a, b)| if and_or { a & b } else { a ^ b }.count_ones() as u64)
.sum();
if rem > 0 {
let mask = (1u8 << rem) - 1;
let last = if and_or { ai[full] & aj[full] } else { ai[full] ^ aj[full] };
n += (last & mask).count_ones() as u64;
}
n
pub(crate) fn col_slice(&self, c: usize) -> BitSliceView<'_> {
BitSliceView::new(self.col_words(c), self.n_rows)
}
fn partial_jaccard_col(&self, i: usize, j: usize) -> (u64, u64) {
let ai = self.col_bytes(i);
let aj = self.col_bytes(j);
let full = self.n_rows / 8;
let rem = self.n_rows % 8;
let (mut inter, mut union) = ai[..full].iter().zip(aj[..full].iter())
.fold((0u64, 0u64), |(inter, union), (a, b)| {
(inter + (a & b).count_ones() as u64,
union + (a | b).count_ones() as u64)
});
if rem > 0 {
let mask = (1u8 << rem) - 1;
inter += ((ai[full] & aj[full]) & mask).count_ones() as u64;
union += ((ai[full] | aj[full]) & mask).count_ones() as u64;
}
(inter, union)
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter().map(|c| self.count_ones_col(c)).collect()
(0..self.n_cols).into_par_iter()
.map(|c| self.col_slice(c).count_ones())
.collect()
)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols;
let results: Vec<(usize, usize, u64, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (inter, union) = self.partial_jaccard_col(i, j); (i, j, inter, union) })
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
pairwise2_matrix(self.n_cols, |i, j| {
self.col_slice(i).partial_jaccard_dist(self.col_slice(j))
})
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
let n = self.n_cols;
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| (i, j, self.pair_op(i, j, false)))
.collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
pairwise_matrix(self.n_cols, |i, j| {
self.col_slice(i).hamming_dist(self.col_slice(j))
})
}
}
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_bit_matrix` to tell a genuinely
/// complete pack from a stale one that predates a later column-widening.
fn packed_bit_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PBMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols;
let packed_path = dir.join("matrix.pbmx");
let col_files: Vec<Vec<u8>> = (0..n_cols)
.map(|c| fs::read(col_path(dir, c)))
.collect::<io::Result<_>>()?;
let meta = match MatrixMeta::load(dir) {
Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pbmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
let header_size = PBMX_HEADER + n_cols * 8;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for data in &col_files {
offsets.push(col_offset as u64);
col_offset += data.len();
// A `matrix.pbmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_bit_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
return Ok(());
}
let packed_path = dir.join("matrix.pbmx");
let mut file = File::create(&packed_path)?;
file.write_all(&PBMX_MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(meta.n as u64).to_le_bytes())?;
file.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { file.write_all(&off.to_le_bytes())?; }
for data in &col_files { file.write_all(data)?; }
drop(file);
let n_cols = meta.n_cols;
// Compute offsets from file sizes — no column data loaded into RAM.
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = (PBMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for &size in &col_sizes {
offsets.push(col_offset);
col_offset += size;
}
// Write to a temp file; rename atomically so a killed process never leaves
// a truncated matrix.pbmx that would be mistaken for a complete file.
let tmp_path = dir.join("matrix.pbmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PBMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols {
io::copy(&mut File::open(col_path(dir, c))?, &mut out)?;
}
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
@@ -326,6 +310,37 @@ impl PersistentBitMatrix {
}
}
pub fn col_view(&self, c: usize) -> BitSliceView<'_> {
match self {
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_slice(c),
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
}
}
/// Column-major point lookup: value at column `c`, slot `slot`, as 0/1.
///
/// Unlike [`col_view`](Self::col_view), this never panics on `Implicit`
/// (every column reads as present, per the mono-genome fast path) — safe
/// to call for any `c < self.n_cols()`.
pub fn get(&self, c: usize, slot: usize) -> u32 {
match self {
Self::Columnar(m) => m.col(c).get(slot) as u32,
Self::Packed(m) => m.col_slice(c).get(slot) as u32,
Self::Implicit { .. } => 1,
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
match self {
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
Self::Implicit { n_rows, .. } => {
PersistentBitVecBuilder::new_ones(*n_rows, path)
}
}
}
pub fn row(&self, slot: usize) -> Box<[bool]> {
match self {
Self::Columnar(m) => m.row(slot),
@@ -422,12 +437,93 @@ impl PersistentBitMatrixBuilder {
PersistentBitVecBuilder::new(self.n, &path)
}
pub fn add_col_ones(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new_ones(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentBitVecBuilder::new(self.n, &path)?;
b.or_where(src.view(), |v| v > 0);
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
// ── Helpers ───────────────────────────────────────────────────────────────────
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
impl MatrixGroupOps for PersistentBitMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempCompactIntVec> {
// Bit matrices store 0/1 — threshold is structurally always 1.
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_present_fast(self.col_view(c));
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_present_fast(self.col_view(c));
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// For bit matrices, sum = count of 1-bits — identical to presence_count.
self.partial_group_presence_count(g, 1)
}
fn partial_group_any(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or(self.col_view(c));
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// min of 0/1 values = AND: 1 only if ALL columns are 1
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.inc_present_fast(self.col_view(first));
for &c in rest { result.mask_with(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// max of 0/1 values = OR: 1 if any column is 1
let any = self.partial_group_any(g, 1)?;
let n = any.len();
let mut result = TempCompactIntVecBuilder::new(n)?;
result.inc_present(any.view());
result.freeze()
}
}
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
@@ -439,3 +535,44 @@ where T: Clone + Default {
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
}
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
/// all upper-triangle pairs, plus `f(i,i)` for the diagonal. `T: Copy` avoids
/// the `.clone()` needed for the lower-triangle mirror.
///
/// The diagonal is *not* generally `T::default()`: for a self-comparison,
/// `f(i,i)` is often the column's own weight (e.g. intersection-with-self —
/// see `pairwise2_matrix`), not zero. Distance finalisations that need a
/// zero diagonal (self-distance) already overwrite it explicitly.
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
let mut m = fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)));
for i in 0..n { m[[i, i]] = f(i, i); }
m
}
/// Same as `pairwise_matrix` but `f` returns two values that fill two
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
/// The diagonal is `f(i,i)` (e.g. a genome's kmer count intersected with
/// itself), not `T::default()` — see `pairwise_matrix` for why that matters.
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (a, b) = f(i, j); (i, j, a, b) })
.collect();
let mut m0 = Array2::from_elem((n, n), T::default());
let mut m1 = Array2::from_elem((n, n), T::default());
for (i, j, a, b) in results {
m0[[i, j]] = a; m0[[j, i]] = a;
m1[[i, j]] = b; m1[[j, i]] = b;
}
for i in 0..n {
let (a, b) = f(i, i);
m0[[i, i]] = a;
m1[[i, i]] = b;
}
(m0, m1)
}
+221 -179
View File
@@ -5,29 +5,25 @@ use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
const MAGIC: [u8; 4] = *b"PBIV";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes.
// Data starts at offset 16, which is divisible by 8 → u64-aligned
// (mmap base is page-aligned, 16 % 8 == 0).
// Data starts at offset 16, u64-aligned (mmap base is page-aligned, 16 % 8 == 0).
const HEADER_SIZE: usize = 16;
#[inline]
fn n_words(n: usize) -> usize {
n.div_ceil(64)
}
pub(crate) fn n_words(n: usize) -> usize { n.div_ceil(64) }
#[inline]
fn n_bytes_for_words(n: usize) -> usize {
n_words(n) * 8
}
fn n_bytes_for_words(n: usize) -> usize { n_words(n) * 8 }
// ── Reader ────────────────────────────────────────────────────────────────────
// ── PersistentBitVec ──────────────────────────────────────────────────────────
pub struct PersistentBitVec {
mmap: Mmap,
n: usize,
n: usize,
path: PathBuf,
}
@@ -35,157 +31,145 @@ impl PersistentBitVec {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(
io::ErrorKind::InvalidData,
"PBIV file too short",
));
return Err(io::Error::new(io::ErrorKind::InvalidData, "PBIV file too short"));
}
if &mmap[0..4] != &MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBIV magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
Ok(Self {
mmap,
n,
path: path.to_path_buf(),
})
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path {
&self.path
}
pub fn len(&self) -> usize {
self.n
}
pub fn is_empty(&self) -> bool {
self.n == 0
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
// Used by iter() and get(): exact byte window, no padding.
fn data_bytes(&self) -> &[u8] {
&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n.div_ceil(8)]
}
// Bulk word view. SAFETY: mmap is page-aligned, HEADER_SIZE=16 is divisible by 8,
// so &mmap[HEADER_SIZE] is u64-aligned. Slice length is n_words * 8 bytes.
// SAFETY: mmap is page-aligned, HEADER_SIZE=16 divisible by 8 → u64-aligned.
fn data_words(&self) -> &[u64] {
let nw = n_words(self.n);
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
pub fn count_ones(&self) -> u64 {
// Padding bits in the last word are 0, so no masking needed.
self.data_words()
.iter()
.map(|w| w.count_ones() as u64)
.sum()
pub fn view(&self) -> BitSliceView<'_> {
BitSliceView::new(self.data_words(), self.n)
}
pub fn count_zeros(&self) -> u64 {
self.n as u64 - self.count_ones()
}
pub fn words(&self) -> &[u64] { self.data_words() }
pub fn jaccard_dist(&self, other: &PersistentBitVec) -> f64 {
let (inter, union) = self.partial_jaccard_dist(other);
if union == 0 {
return 0.0;
}
1.0 - inter as f64 / union as f64
}
pub fn count_ones(&self) -> u64 { self.view().count_ones() }
pub fn count_zeros(&self) -> u64 { self.view().count_zeros() }
pub fn partial_jaccard_dist(&self, other: &PersistentBitVec) -> (u64, u64) {
assert_eq!(self.n, other.n, "length mismatch");
self.data_words()
.iter()
.zip(other.data_words())
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
(
i + (a & b).count_ones() as u64,
u + (a | b).count_ones() as u64,
)
})
self.view().partial_jaccard_dist(other.view())
}
pub fn jaccard_dist(&self, other: &PersistentBitVec) -> f64 {
self.view().jaccard_dist(other.view())
}
pub fn hamming_dist(&self, other: &PersistentBitVec) -> u64 {
assert_eq!(self.n, other.n, "length mismatch");
self.data_words()
.iter()
.zip(other.data_words())
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
.sum()
self.view().hamming_dist(other.view())
}
pub fn iter(&self) -> BitIter<'_> {
BitIter {
bytes: self.data_bytes(),
slot: 0,
n: self.n,
}
BitIter { words: self.data_words(), slot: 0, n: self.n }
}
}
impl<'a> IntoIterator for &'a PersistentBitVec {
type Item = bool;
type IntoIter = BitIter<'a>;
fn into_iter(self) -> BitIter<'a> {
self.iter()
}
fn into_iter(self) -> BitIter<'a> { self.iter() }
}
// ── BitIter ───────────────────────────────────────────────────────────────────
pub struct BitIter<'a> {
bytes: &'a [u8],
slot: usize,
n: usize,
words: &'a [u64],
slot: usize,
n: usize,
}
impl ExactSizeIterator for BitIter<'_> {}
impl Iterator for BitIter<'_> {
type Item = bool;
fn next(&mut self) -> Option<bool> {
if self.slot >= self.n {
return None;
}
let v = (self.bytes[self.slot >> 3] >> (self.slot & 7)) & 1 != 0;
if self.slot >= self.n { return None; }
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
self.slot += 1;
Some(v)
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
// ── Builder ───────────────────────────────────────────────────────────────────
// ── PersistentBitVecBuilder ───────────────────────────────────────────────────
pub struct PersistentBitVecBuilder {
mmap: MmapMut,
n: usize,
n: usize,
path: PathBuf,
}
impl PersistentBitVecBuilder {
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let mut file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?; // padding
file.write_all(&[0u8; 4])?;
file.write_all(&(n as u64).to_le_bytes())?;
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn from_raw_bytes(bytes: &[u8], n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
mmap[HEADER_SIZE..HEADER_SIZE + bytes.len()].copy_from_slice(bytes);
Ok(Self { mmap, n, path: path.to_path_buf() })
}
/// Create an all-ones bit vector of length `n` at `path`.
///
/// More efficient than `new(n, path)` + `not()`: the data is written as
/// 0xFF bytes in a single sequential pass, with no intermediate all-zeros state.
pub fn new_ones(n: usize, path: &Path) -> io::Result<Self> {
let nw = n_words(n);
let file_size = HEADER_SIZE + nw * 8;
let mut file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(n as u64).to_le_bytes())?;
file.write_all(&vec![0xFFu8; nw * 8])?;
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
// Clear padding bits in the last word so trailing bits are always 0.
let rem = n % 64;
if rem != 0 {
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
words[nw - 1] &= (1u64 << rem) - 1;
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn build_from(source: &PersistentBitVec, path: &Path) -> io::Result<Self> {
@@ -193,86 +177,14 @@ impl PersistentBitVecBuilder {
let file = OpenOptions::new().read(true).write(true).open(path)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
let n = source.len();
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize {
self.n
}
pub fn is_empty(&self) -> bool {
self.n == 0
}
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
pub fn set(&mut self, slot: usize, value: bool) {
let byte = HEADER_SIZE + (slot >> 3);
let bit = 1u8 << (slot & 7);
if value {
self.mmap[byte] |= bit;
} else {
self.mmap[byte] &= !bit;
}
}
// SAFETY: same alignment argument as PersistentBitVec::data_words.
fn data_words_mut(&mut self) -> &mut [u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
}
pub fn and(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw &= ow;
}
}
pub fn or(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw |= ow;
}
}
pub fn xor(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw ^= ow;
}
}
pub fn not(&mut self) {
let rem = self.n % 64;
let words = self.data_words_mut();
for w in words.iter_mut() {
*w ^= u64::MAX;
}
// Zero padding bits in the last word so count_ones / jaccard remain correct.
if rem != 0 {
if let Some(last) = words.last_mut() {
*last &= (1u64 << rem) - 1;
}
}
}
/// Convert a count vector to a bit vector: bit set iff count >= threshold.
/// Fills u64 words directly from the count iterator — O(n), no bit-level set() overhead.
pub fn build_from_counts(
source: &PersistentCompactIntVec,
threshold: u32,
path: &Path,
) -> io::Result<Self> {
pub fn build_from_counts(source: &PersistentCompactIntVec, threshold: u32, path: &Path) -> io::Result<Self> {
let n = source.len();
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let mut file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?;
@@ -280,27 +192,157 @@ impl PersistentBitVecBuilder {
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
{
let nw = n_words(n);
let nw = n_words(n);
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
for (slot, count) in source.iter().enumerate() {
if count >= threshold {
words[slot >> 6] |= 1u64 << (slot & 63);
}
if count >= threshold { words[slot >> 6] |= 1u64 << (slot & 63); }
}
}
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
/// Convert a count vector to a presence/absence bit vector (threshold = 1).
pub fn build_from_presence(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
Self::build_from_counts(source, 1, path)
}
pub fn close(self) -> io::Result<()> {
self.mmap.flush()
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
pub fn set(&mut self, slot: usize, value: bool) {
let bit = 1u64 << (slot & 63);
if value { self.data_words_mut()[slot >> 6] |= bit; }
else { self.data_words_mut()[slot >> 6] &= !bit; }
}
fn data_words(&self) -> &[u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
// SAFETY: same alignment argument as PersistentBitVec::data_words.
fn data_words_mut(&mut self) -> &mut [u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
}
pub fn view(&self) -> BitSliceView<'_> {
BitSliceView::new(self.data_words(), self.n)
}
pub fn words(&self) -> &[u64] { self.data_words() }
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
assert_eq!(self.n, src.len(), "BitSliceView length mismatch");
self.data_words_mut().copy_from_slice(src.words());
}
pub fn and(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w &= o; }
}
pub fn or(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w |= o; }
}
pub fn xor(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w ^= o; }
}
pub fn not(&mut self) {
let rem = self.n % 64;
let words = self.data_words_mut();
for w in words.iter_mut() { *w ^= u64::MAX; }
if rem != 0 {
if let Some(last) = words.last_mut() { *last &= (1u64 << rem) - 1; }
}
}
/// OR in bits at slots where `pred(col[slot])` is true.
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] |= mask;
}
for (slot, val) in col.overflow_entries() {
if pred(val) { words[slot >> 6] |= 1u64 << (slot & 63); }
}
}
/// Clear bits at slots where `pred(col[slot])` is false.
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && !pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] &= !mask;
}
for (slot, val) in col.overflow_entries() {
if !pred(val) { words[slot >> 6] &= !(1u64 << (slot & 63)); }
}
}
/// Toggle bits at slots where `pred(col[slot])` is true.
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] ^= mask;
}
for (slot, val) in col.overflow_entries() {
if pred(val) { words[slot >> 6] ^= 1u64 << (slot & 63); }
}
}
pub fn iter(&self) -> BitSliceIter<'_> {
self.view().iter()
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<PersistentBitVec> {
let path = self.path.clone();
self.close()?;
PersistentBitVec::open(&path)
}
}
+195 -69
View File
@@ -5,71 +5,57 @@ use std::path::{Path, PathBuf};
use memmap2::MmapMut;
use crate::format::{HEADER_SIZE, OVERFLOW_ENTRY_SIZE, finalize_pciv};
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, finalize_pciv, parse_overflow_entry};
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceView, IntSliceView};
pub struct PersistentCompactIntVecBuilder {
path: PathBuf,
mmap: MmapMut,
n: usize,
path: PathBuf,
mmap: MmapMut,
n: usize,
overflow: HashMap<usize, u32>,
}
impl PersistentCompactIntVecBuilder {
/// Create a new, zero-filled PCIV at `path`. Primary is mmapped immediately.
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len((HEADER_SIZE + n) as u64)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
Ok(Self {
path: path.to_path_buf(),
mmap,
n,
overflow: HashMap::new(),
})
Ok(Self { path: path.to_path_buf(), mmap, n, overflow: HashMap::new() })
}
pub fn from_raw_primary(primary: &[u8], overflow: HashMap<usize, u32>, path: &Path) -> io::Result<Self> {
let n = primary.len();
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len((HEADER_SIZE + n) as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[HEADER_SIZE..HEADER_SIZE + n].copy_from_slice(primary);
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
}
/// Copy `source`'s file to `path`, mmap the primary section, load overflow into RAM.
/// Avoids iterating all n slots: the file copy is OS-level, overflow loading is O(n_overflow).
pub fn build_from(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
fs::copy(source.path(), path)?;
let file = OpenOptions::new().read(true).write(true).open(path)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
let n = source.len();
let n = source.len();
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let data_offset = HEADER_SIZE + n;
let mut overflow = HashMap::with_capacity(n_overflow);
for i in 0..n_overflow {
let off = data_offset + i * OVERFLOW_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[off..off + 8].try_into().unwrap()) as usize;
let value = u32::from_le_bytes(mmap[off + 8..off + 12].try_into().unwrap());
let (slot, value) = parse_overflow_entry(&mmap, data_offset, i);
overflow.insert(slot, value);
}
Ok(Self {
path: path.to_path_buf(),
mmap,
n,
overflow,
})
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
}
/// Get the value at the given slot, handling overflow if necessary.
pub fn get(&self, slot: usize) -> u32 {
match self.mmap[HEADER_SIZE + slot] {
255 => *self
.overflow
.get(&slot)
.expect("sentinel without overflow entry"),
v => v as u32,
255 => *self.overflow.get(&slot).expect("sentinel without overflow entry"),
v => v as u32,
}
}
@@ -83,61 +69,201 @@ impl PersistentCompactIntVecBuilder {
}
}
pub fn len(&self) -> usize {
self.n
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn primary_bytes(&self) -> &[u8] { &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { &mut self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
pub fn clear_overflow(&mut self) { self.overflow.clear(); }
pub fn sum(&self) -> u64 {
byte_sum(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n], self.overflow.values().copied())
}
pub fn count_nonzero(&self) -> u64 {
byte_count_nonzero(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n])
}
pub fn is_empty(&self) -> bool {
self.n == 0
pub fn view(&self) -> IntSliceView<'_> {
// Builder overflow is a HashMap, not sorted raw bytes — convert on the fly
// by collecting into a sorted vec and storing in a thread-local buffer.
// For read-back during building, just call get(slot) directly.
// view() is primarily useful AFTER freeze (on PersistentCompactIntVec).
// Here we expose it via a zero-alloc path: primary only, no overflow raw.
// Callers that need overflow_entries during building use overflow_entries().
let primary = &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n];
IntSliceView::new(primary, &[], 0, self.n)
}
pub fn min(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
if other_val < self.get(slot) {
self.set(slot, other_val);
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
self.overflow.iter().map(|(&k, &v)| (k, v))
}
pub fn inc(&mut self, slot: usize) {
let v = self.get(slot);
self.set(slot, v.saturating_add(1));
}
// ── Computation methods ───────────────────────────────────────────────────
/// Increment one counter per 1-bit of `col`. Safe for any group size.
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
let n = self.n;
for (wi, &word) in col.words().iter().enumerate() {
if word == 0 { continue; }
let mut w = word;
while w != 0 {
let bit = w.trailing_zeros() as usize;
let slot = wi * 64 + bit;
if slot < n { self.inc(slot); }
w &= w - 1;
}
}
}
pub fn max(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
if other_val > self.get(slot) {
self.set(slot, other_val);
/// Increment one counter per 1-bit of `col`, using raw u8 arithmetic.
/// Caller guarantees no counter will reach 255 (group size < 255).
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
{
let primary = self.primary_bytes_mut();
let n = primary.len();
for (wi, &word) in col.words().iter().enumerate() {
if word == 0 { continue; }
let mut w = word;
while w != 0 {
let bit = w.trailing_zeros() as usize;
let s = wi * 64 + bit;
if s < n { primary[s] += 1; }
w &= w - 1;
}
}
}
debug_assert!(
!self.primary_bytes().contains(&255),
"sentinel 255 reached in inc_present_fast — group size must be < 255"
);
}
/// Two-pass: primary bytes then overflow. Increments `self[slot]` for each
/// slot where `pred(col[slot])` is true. Safe for any group size.
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
let n = col.len();
for slot in 0..n {
let b = col.primary_bytes()[slot];
if b < 255 && pred(b as u32) {
self.inc(slot);
}
}
for (slot, val) in col.overflow_entries() {
if pred(val) { self.inc(slot); }
}
}
/// Fast two-pass: raw u8 arithmetic. Caller guarantees no counter reaches 255.
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
let n = col.len();
{
let primary = self.primary_bytes_mut();
for slot in 0..n {
let b = col.primary_bytes()[slot];
if b < 255 && pred(b as u32) {
primary[slot] += 1;
}
}
}
for (slot, val) in col.overflow_entries() {
if pred(val) { self.primary_bytes_mut()[slot] += 1; }
}
debug_assert!(
!self.primary_bytes().contains(&255),
"sentinel 255 reached in inc_predicate_fast — group size must be < 255"
);
}
pub fn add(&mut self, other: IntSliceView<'_>) {
let n = self.n;
for s in 0..n {
let sb = self.primary_bytes()[s];
let ob = other.primary_bytes()[s];
if sb < 255 && ob < 255 {
let sum = sb as u32 + ob as u32;
if sum < 255 { self.primary_bytes_mut()[s] = sum as u8; }
else { self.set(s, sum); }
} else {
let sv = self.get(s);
let ov = other.get(s);
self.set(s, sv + ov);
}
}
}
pub fn add(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
let cur = self.get(slot);
self.set(slot, cur.checked_add(other_val).expect("u32 overflow in add"));
pub fn min(&mut self, other: IntSliceView<'_>) {
let self_ov: Vec<(usize, u32)> = self.overflow_entries().collect();
let other_ov: HashMap<usize, u32> = other.overflow_entries().collect();
self.clear_overflow();
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
if b < *a { *a = b; }
}
for (slot, self_val) in self_ov {
if let Some(&other_val) = other_ov.get(&slot) {
self.set(slot, self_val.min(other_val));
}
}
}
pub fn diff(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
self.set(slot, self.get(slot).saturating_sub(other_val));
pub fn max(&mut self, other: IntSliceView<'_>) {
for (slot, other_val) in other.overflow_entries() {
let sv = self.get(slot);
self.set(slot, sv.max(other_val));
}
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
if b > *a { *a = b; }
}
}
pub fn diff(&mut self, other: IntSliceView<'_>) {
let n = self.n;
for s in 0..n {
let sb = self.primary_bytes()[s];
let ob = other.primary_bytes()[s];
if sb < 255 {
self.primary_bytes_mut()[s] = if ob < 255 { sb.saturating_sub(ob) } else { 0 };
} else {
let sv = self.get(s);
let ov = if ob < 255 { ob as u32 } else { other.get(s) };
self.set(s, sv.saturating_sub(ov));
}
}
}
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
let n = self.n;
for (wi, &word) in mask.words().iter().enumerate() {
if word == u64::MAX { continue; }
let mut zeros = !word;
while zeros != 0 {
let bit = zeros.trailing_zeros() as usize;
let s = wi * 64 + bit;
if s < n {
let b = self.primary_bytes()[s];
if b != 0 { self.set(s, 0); }
}
zeros &= zeros - 1;
}
}
}
/// Flush the primary mmap, then write sorted overflow data + index and fix the header.
pub fn close(self) -> io::Result<()> {
self.mmap.flush()?;
let Self {
path,
mmap,
n,
overflow,
} = self;
let Self { path, mmap, n, overflow } = self;
drop(mmap);
let mut entries: Vec<(usize, u32)> = overflow.into_iter().collect();
entries.sort_unstable_by_key(|&(slot, _)| slot);
finalize_pciv(&path, n, &entries)
}
pub fn finish(self) -> io::Result<PersistentCompactIntVec> {
let path = self.path.clone();
self.close()?;
PersistentCompactIntVec::open(&path)
}
}
+137
View File
@@ -0,0 +1,137 @@
use std::io;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::TempCompactIntVec;
// ── ColGroup ──────────────────────────────────────────────────────────────────
/// A named subset of columns, identified by their indices within the matrix.
///
/// Defined once at the index level; the same indices are valid across all
/// partitions and layers because the column structure (samples / genomes) is
/// identical everywhere — only the row space (kmer slots) is partitioned.
pub struct ColGroup {
pub name: String,
pub indices: Vec<usize>,
}
impl ColGroup {
pub fn new(name: impl Into<String>, indices: Vec<usize>) -> Self {
Self { name: name.into(), indices }
}
}
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
/// Per-matrix group aggregations.
///
/// `partial_group_presence_count`, `partial_group_sum`, `partial_group_any`,
/// `partial_group_min`, `partial_group_max` are the primitives; each impl must
/// provide all five.
///
/// `partial_group_all` and `partial_group_none` have default implementations
/// derived from `partial_group_presence_count` and should rarely need overriding.
pub trait MatrixGroupOps {
/// Per-slot count of group columns whose value ≥ `threshold`.
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec>;
/// Per-slot sum of values across all group columns.
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot OR: 1 if any group column has value ≥ `threshold`.
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec>;
/// Per-slot min value across all group columns (0 if group is empty).
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot max value across all group columns (0 if group is empty).
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot AND: 1 if ALL group columns have value ≥ `threshold`.
fn partial_group_all(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let counts = self.partial_group_presence_count(g, threshold)?;
let n = counts.len();
let n_required = g.indices.len() as u32;
let mut b = TempBitVecBuilder::new(n)?;
b.or_where(counts.view(), |v| v >= n_required);
b.freeze()
}
/// Per-slot NOR: 1 if NO group column has value ≥ `threshold`.
fn partial_group_none(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let counts = self.partial_group_presence_count(g, threshold)?;
let n = counts.len();
let mut b = TempBitVecBuilder::new(n)?;
b.or_where(counts.view(), |v| v == 0);
b.freeze()
}
}
// ── FilterMask — expression tree for column-based slot filters ────────────────
/// A composable filter expression that can be evaluated against a matrix
/// using only column operations (no MPHF lookup per kmer).
///
/// `threshold` semantics follow [`MatrixGroupOps::partial_group_presence_count`]:
/// a slot contributes to the count when its value is **≥ threshold**.
/// To match the row-level filter (`value > t`), callers should pass `t + 1`.
#[derive(Debug, Clone)]
pub enum FilterMask {
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≥ `min_count`.
PresenceGeq { indices: Vec<usize>, threshold: u32, min_count: usize },
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≤ `max_count`.
PresenceLeq { indices: Vec<usize>, threshold: u32, max_count: usize },
/// Slot passes if sum of values across `indices` columns is ≥ `min_sum`.
SumGeq { indices: Vec<usize>, min_sum: u32 },
/// Slot passes if sum of values across `indices` columns is ≤ `max_sum`.
SumLeq { indices: Vec<usize>, max_sum: u32 },
/// Slot passes if it passes all sub-expressions. Empty `And` is always true.
And(Vec<FilterMask>),
}
/// Evaluate a [`FilterMask`] against `mat`, returning a per-slot `TempBitVec`
/// where bit=1 means the slot passes the filter.
pub fn eval_filter_mask(expr: &FilterMask, mat: &dyn MatrixGroupOps, n: usize) -> io::Result<TempBitVec> {
match expr {
FilterMask::PresenceGeq { indices, threshold, min_count } => {
let g = ColGroup::new("", indices.clone());
let counts = mat.partial_group_presence_count(&g, *threshold)?;
let mut b = TempBitVecBuilder::new(n)?;
let mc = *min_count as u32;
b.or_where(counts.view(), |v| v >= mc);
b.freeze()
}
FilterMask::PresenceLeq { indices, threshold, max_count } => {
let g = ColGroup::new("", indices.clone());
let counts = mat.partial_group_presence_count(&g, *threshold)?;
let mut b = TempBitVecBuilder::new(n)?;
let mc = *max_count as u32;
b.or_where(counts.view(), |v| v <= mc);
b.freeze()
}
FilterMask::SumGeq { indices, min_sum } => {
let g = ColGroup::new("", indices.clone());
let sums = mat.partial_group_sum(&g)?;
let mut b = TempBitVecBuilder::new(n)?;
let ms = *min_sum;
b.or_where(sums.view(), |v| v >= ms);
b.freeze()
}
FilterMask::SumLeq { indices, max_sum } => {
let g = ColGroup::new("", indices.clone());
let sums = mat.partial_group_sum(&g)?;
let mut b = TempBitVecBuilder::new(n)?;
let ms = *max_sum;
b.or_where(sums.view(), |v| v <= ms);
b.freeze()
}
FilterMask::And(parts) => {
let mut b = TempBitVecBuilder::new_ones(n)?;
for part in parts {
let m = eval_filter_mask(part, mat, n)?;
b.and(m.view());
}
b.freeze()
}
}
}
+38
View File
@@ -13,6 +13,44 @@ pub const OVERFLOW_ENTRY_SIZE: usize = 12;
// Index entry: slot(u64) + pos(u64) = 16 bytes.
pub const INDEX_ENTRY_SIZE: usize = 16;
/// Sum all values in a compact-int primary byte slice, correcting for overflow sentinels.
///
/// `primary` is the raw `&[u8]` where 255 is a sentinel for large values.
/// `overflow` yields the true values (≥ 255) for each sentinel, in any order.
#[inline]
pub(crate) fn byte_sum(primary: &[u8], overflow: impl Iterator<Item = u32>) -> u64 {
let raw: u64 = primary.iter().map(|&b| b as u64).sum();
let (n, ov) = overflow.fold((0u64, 0u64), |(n, s), v| (n + 1, s + v as u64));
raw - 255 * n + ov
}
/// Count non-zero values in a compact-int primary byte slice.
///
/// Overflow sentinels (255) are always non-zero by construction, so a single
/// `b != 0` test is sufficient — no overflow map lookup needed.
#[inline]
pub(crate) fn byte_count_nonzero(primary: &[u8]) -> u64 {
primary.iter().filter(|&&b| b != 0).count() as u64
}
/// Parse a single overflow entry `(slot, value)` from a byte slice.
#[inline]
pub fn parse_overflow_entry(data: &[u8], base: usize, i: usize) -> (usize, u32) {
let off = base + i * OVERFLOW_ENTRY_SIZE;
let slot = u64::from_le_bytes(data[off..off+8].try_into().unwrap()) as usize;
let value = u32::from_le_bytes(data[off+8..off+12].try_into().unwrap());
(slot, value)
}
/// Parse a single sparse-index entry `(slot, pos)` from a byte slice.
#[inline]
pub fn parse_index_entry(data: &[u8], base: usize, i: usize) -> (usize, usize) {
let off = base + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(data[off..off+8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(data[off+8..off+16].try_into().unwrap()) as usize;
(slot, pos)
}
// Sparse index target: ≤ 32 KB in L1 cache (16 B per entry → 2048 entries).
pub const L1_INDEX_ENTRIES: usize = 2048;
+209 -220
View File
@@ -1,16 +1,20 @@
use std::cmp::Ordering;
use std::fs::{self, File};
use std::io::{self, Write as _};
use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitmatrix::{pairwise_matrix, pairwise2_matrix};
use crate::builder::PersistentCompactIntVecBuilder;
use crate::format::{HEADER_SIZE, INDEX_ENTRY_SIZE, OVERFLOW_ENTRY_SIZE};
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::format::{HEADER_SIZE, OVERFLOW_ENTRY_SIZE};
use crate::meta::MatrixMeta;
use crate::reader::PersistentCompactIntVec;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use crate::views::IntSliceView;
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pciv"))
@@ -41,9 +45,7 @@ impl ColumnarCompactIntMatrix {
}
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, col) in self.cols.iter().enumerate() {
buf[c] = col.get(slot);
}
for (c, col) in self.cols.iter().enumerate() { buf[c] = col.get(slot); }
}
pub(crate) fn sum(&self) -> Array1<u64> {
@@ -54,50 +56,35 @@ impl ColumnarCompactIntMatrix {
Array1::from_vec(sums)
}
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.col(i).partial_bray_dist(self.col(j)))
}
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).partial_euclidean_dist(self.col(j)))
}
pub(crate) fn partial_threshold_jaccard_dist_matrix(
&self, threshold: u32,
) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols();
let pairs = upper_pairs(n);
let results: Vec<(usize, usize, u64, u64)> = pairs
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
let counts: Vec<u64> = (0..self.n_cols())
.into_par_iter()
.map(|(i, j)| {
let (inter, union) =
self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold);
(i, j, inter, union)
})
.map(|c| self.col(c).count_nonzero())
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
Array1::from_vec(counts)
}
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_bray_dist(self.col(j)))
}
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_euclidean_dist(self.col(j)))
}
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold))
}
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_relfreq_bray_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_relfreq_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_hellinger_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
@@ -110,20 +97,6 @@ impl ColumnarCompactIntMatrix {
meta.n_cols += 1;
meta.save(dir)
}
fn pairwise(&self, f: impl Fn(usize, usize) -> f64 + Sync) -> Array2<f64> {
let n = self.n_cols();
let results: Vec<(usize, usize, f64)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
fn pairwise_u64(&self, f: impl Fn(usize, usize) -> u64 + Sync) -> Array2<u64> {
let n = self.n_cols();
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
}
// ── PackedCompactIntMatrix ────────────────────────────────────────────────────
@@ -131,13 +104,10 @@ impl ColumnarCompactIntMatrix {
const PCMX_MAGIC: [u8; 4] = *b"PCMX";
const PCMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
/// Per-column metadata pre-parsed from the embedded PCIV header.
struct ColInfo {
primary_start: usize, // absolute mmap offset to primary array
data_offset: usize, // absolute mmap offset to overflow array
primary_start: usize,
data_offset: usize,
n_overflow: usize,
step: usize,
index: Vec<(usize, usize)>,
}
pub struct PackedCompactIntMatrix {
@@ -163,61 +133,31 @@ impl PackedCompactIntMatrix {
for c in 0..n_cols {
let off_pos = PCMX_HEADER + c * 8;
let col_base = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
// Parse embedded PCIV header at col_base
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
let n_idx = u64::from_le_bytes(mmap[col_base+24..col_base+32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[col_base+32..col_base+40].try_into().unwrap()) as usize;
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
let primary_start = col_base + HEADER_SIZE;
let data_offset = primary_start + n_pciv;
let index_offset = data_offset + n_ov * OVERFLOW_ENTRY_SIZE;
let mut index = Vec::with_capacity(n_idx);
for i in 0..n_idx {
let ioff = index_offset + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[ioff..ioff+8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(mmap[ioff+8..ioff+16].try_into().unwrap()) as usize;
index.push((slot, pos));
}
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov, step, index });
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov });
}
Ok(Self { mmap, n_rows, n_cols, columns })
}
#[inline]
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 {
let ci = &self.columns[col];
let v = self.mmap[ci.primary_start + slot];
if v < 255 { return v as u32; }
self.overflow_get(ci, slot)
pub(crate) fn col_view(&self, c: usize) -> IntSliceView<'_> {
let ci = &self.columns[c];
let primary = &self.mmap[ci.primary_start..ci.primary_start + self.n_rows];
let overflow_raw = &self.mmap[ci.data_offset..ci.data_offset + ci.n_overflow * OVERFLOW_ENTRY_SIZE];
IntSliceView::new(primary, overflow_raw, ci.n_overflow, self.n_rows)
}
fn overflow_get(&self, ci: &ColInfo, slot: usize) -> u32 {
let (pos_start, pos_end) = if ci.step == 0 {
(0, ci.n_overflow)
} else {
let i = ci.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
let start = ci.index[i].1;
let end = if i + 1 < ci.index.len() { ci.index[i+1].1 } else { ci.n_overflow };
(start, end)
};
let mut lo = pos_start;
let mut hi = pos_end;
while lo < hi {
let mid = lo + (hi - lo) / 2;
let off = ci.data_offset + mid * OVERFLOW_ENTRY_SIZE;
let stored = u64::from_le_bytes(self.mmap[off..off+8].try_into().unwrap()) as usize;
match stored.cmp(&slot) {
Ordering::Equal => return u32::from_le_bytes(self.mmap[off+8..off+12].try_into().unwrap()),
Ordering::Less => lo = mid + 1,
Ordering::Greater => hi = mid,
}
}
panic!("slot {slot} marked overflow but not found")
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
let view = self.col_view(c);
let overflow: std::collections::HashMap<usize, u32> = view.overflow_entries().collect();
PersistentCompactIntVecBuilder::from_raw_primary(view.primary_bytes(), overflow, path)
}
#[inline]
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 { self.col_view(col).get(slot) }
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for c in 0..self.n_cols { buf[c] = self.get(c, slot); }
}
@@ -228,141 +168,123 @@ impl PackedCompactIntMatrix {
pub(crate) fn sum(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter()
.map(|c| (0..self.n_rows).map(|s| self.get(c, s) as u64).sum())
.collect()
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).sum()).collect()
)
}
// ── Pair primitives ───────────────────────────────────────────────────────
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).count_nonzero()).collect()
)
}
fn pair_partial_bray(&self, i: usize, j: usize) -> u64 {
(0..self.n_rows).map(|s| self.get(i, s).min(self.get(j, s)) as u64).sum()
self.col_view(i).iter().zip(self.col_view(j).iter()).map(|(a, b)| a.min(b) as u64).sum()
}
fn pair_partial_euclidean(&self, i: usize, j: usize) -> f64 {
(0..self.n_rows).map(|s| {
let d = self.get(i, s) as f64 - self.get(j, s) as f64;
d * d
}).sum()
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d }).sum()
}
fn pair_partial_threshold_jaccard(&self, i: usize, j: usize, t: u32) -> (u64, u64) {
let (mut inter, mut union) = (0u64, 0u64);
for s in 0..self.n_rows {
let a = self.get(i, s) >= t;
let b = self.get(j, s) >= t;
if a && b { inter += 1; }
if a || b { union += 1; }
}
(inter, union)
self.col_view(i).iter().zip(self.col_view(j).iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= t; let bp = b >= t;
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
})
}
fn pair_partial_relfreq_bray(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
(0..self.n_rows).map(|s| {
(self.get(i, s) as f64 / si).min(self.get(j, s) as f64 / sj)
}).sum()
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| (a as f64 / si).min(b as f64 / sj)).sum()
}
fn pair_partial_relfreq_euclidean(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
(0..self.n_rows).map(|s| {
let d = self.get(i, s) as f64 / si - self.get(j, s) as f64 / sj;
d * d
}).sum()
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = a as f64 / si - b as f64 / sj; d * d }).sum()
}
fn pair_partial_hellinger(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
(0..self.n_rows).map(|s| {
let d = (self.get(i, s) as f64 / si).sqrt() - (self.get(j, s) as f64 / sj).sqrt();
d * d
}).sum()
}
// ── Matrix methods ────────────────────────────────────────────────────────
fn pairwise<T>(&self, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Clone + Default + Send {
let n = self.n_cols;
let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| { let w = v.clone(); (i, j, v, w) }))
}
fn pairwise_u64(&self, f: impl Fn(usize, usize) -> u64 + Sync) -> Array2<u64> {
let n = self.n_cols;
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = (a as f64 / si).sqrt() - (b as f64 / sj).sqrt(); d * d }).sum()
}
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.pair_partial_bray(i, j))
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_bray(i, j))
}
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.pair_partial_euclidean(i, j))
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_euclidean(i, j))
}
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, t: u32) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols;
let results: Vec<(usize, usize, u64, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (inter, union) = self.pair_partial_threshold_jaccard(i, j, t); (i, j, inter, union) })
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
pairwise2_matrix(self.n_cols, |i, j| self.pair_partial_threshold_jaccard(i, j, t))
}
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| self.pair_partial_relfreq_bray(i, j, col_sums[i] as f64, col_sums[j] as f64))
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_bray(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| self.pair_partial_relfreq_euclidean(i, j, col_sums[i] as f64, col_sums[j] as f64))
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_euclidean(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| self.pair_partial_hellinger(i, j, col_sums[i] as f64, col_sums[j] as f64))
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_hellinger(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
}
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_compact_int_matrix` to tell a
/// genuinely complete pack from a stale one that predates a later
/// column-widening.
fn packed_int_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PCMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `counts/matrix.pcmx` from existing `col_*.pciv` files.
pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols;
let packed_path = dir.join("matrix.pcmx");
let col_files: Vec<Vec<u8>> = (0..n_cols)
.map(|c| fs::read(col_path(dir, c)))
.collect::<io::Result<_>>()?;
let meta = match MatrixMeta::load(dir) {
Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pcmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
let header_size = PCMX_HEADER + n_cols * 8;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for data in &col_files {
offsets.push(col_offset as u64);
col_offset += data.len();
// A `matrix.pcmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_int_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
return Ok(());
}
let packed_path = dir.join("matrix.pcmx");
let mut file = File::create(&packed_path)?;
file.write_all(&PCMX_MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(meta.n as u64).to_le_bytes())?;
file.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { file.write_all(&off.to_le_bytes())?; }
for data in &col_files { file.write_all(data)?; }
drop(file);
let n_cols = meta.n_cols;
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = (PCMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for &size in &col_sizes { offsets.push(col_offset); col_offset += size; }
let tmp_path = dir.join("matrix.pcmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PCMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols { io::copy(&mut File::open(col_path(dir, c))?, &mut out)?; }
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
Ok(())
@@ -376,18 +298,14 @@ pub enum PersistentCompactIntMatrix {
}
impl PersistentCompactIntMatrix {
/// Open from `layer_dir`, auto-detecting Packed or Columnar.
pub fn open(layer_dir: &Path) -> io::Result<Self> {
let counts_dir = layer_dir.join("counts");
if counts_dir.join("matrix.pcmx").exists() {
return Ok(Self::Packed(PackedCompactIntMatrix::open(&counts_dir.join("matrix.pcmx"))?));
}
if MatrixMeta::load(&counts_dir).is_ok() {
return Ok(Self::Columnar(ColumnarCompactIntMatrix::open(&counts_dir)?));
}
Err(io::Error::new(
io::ErrorKind::NotFound,
format!("no count matrix found in {} — run 'obikmer upgrade'", layer_dir.display()),
@@ -397,7 +315,6 @@ impl PersistentCompactIntMatrix {
pub fn n(&self) -> usize {
match self { Self::Columnar(m) => m.n(), Self::Packed(m) => m.n_rows }
}
pub fn n_cols(&self) -> usize {
match self { Self::Columnar(m) => m.n_cols(), Self::Packed(m) => m.n_cols }
}
@@ -409,18 +326,32 @@ impl PersistentCompactIntMatrix {
}
}
pub fn col_view(&self, c: usize) -> IntSliceView<'_> {
match self {
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_view(c),
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
match self {
Self::Columnar(m) => PersistentCompactIntVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
}
}
pub fn row(&self, slot: usize) -> Box<[u32]> {
match self { Self::Columnar(m) => m.row(slot), Self::Packed(m) => m.row(slot) }
}
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
match self { Self::Columnar(m) => m.fill_row(slot, buf), Self::Packed(m) => m.fill_row(slot, buf) }
}
pub fn sum(&self) -> Array1<u64> {
match self { Self::Columnar(m) => m.sum(), Self::Packed(m) => m.sum() }
}
pub fn count_nonzero(&self) -> Array1<u64> {
match self { Self::Columnar(m) => m.count_nonzero(), Self::Packed(m) => m.count_nonzero() }
}
pub fn partial_bray_dist_matrix(&self) -> Array2<u64> {
match self { Self::Columnar(m) => m.partial_bray_dist_matrix(), Self::Packed(m) => m.partial_bray_dist_matrix() }
}
@@ -439,7 +370,6 @@ impl PersistentCompactIntMatrix {
pub fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums), Self::Packed(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums) }
}
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> u32) -> io::Result<()> {
ColumnarCompactIntMatrix::append_column(dir, value_of)
}
@@ -451,15 +381,16 @@ use crate::traits::{ColumnWeights, CountPartials};
impl ColumnWeights for PersistentCompactIntMatrix {
fn col_weights(&self) -> Array1<u64> { self.sum() }
fn partial_kmer_counts(&self) -> Array1<u64> { self.count_nonzero() }
}
impl CountPartials for PersistentCompactIntMatrix {
fn partial_bray(&self) -> Array2<u64> { self.partial_bray_dist_matrix() }
fn partial_euclidean(&self) -> Array2<f64> { self.partial_euclidean_dist_matrix() }
fn partial_bray(&self) -> Array2<u64> { self.partial_bray_dist_matrix() }
fn partial_euclidean(&self) -> Array2<f64> { self.partial_euclidean_dist_matrix() }
fn partial_threshold_jaccard(&self, t: u32) -> (Array2<u64>, Array2<u64>) { self.partial_threshold_jaccard_dist_matrix(t) }
fn partial_relfreq_bray(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_bray_dist_matrix(g) }
fn partial_relfreq_euclidean(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_euclidean_dist_matrix(g) }
fn partial_hellinger(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_hellinger_euclidean_dist_matrix(g) }
fn partial_relfreq_bray(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_bray_dist_matrix(g) }
fn partial_relfreq_euclidean(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_euclidean_dist_matrix(g) }
fn partial_hellinger(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_hellinger_euclidean_dist_matrix(g) }
}
// ── Builder ───────────────────────────────────────────────────────────────────
@@ -475,30 +406,88 @@ impl PersistentCompactIntMatrixBuilder {
fs::create_dir_all(dir)?;
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
}
pub fn n(&self) -> usize { self.n }
pub fn n_cols(&self) -> usize { self.n_cols }
pub fn add_col(&mut self) -> io::Result<PersistentCompactIntVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentCompactIntVecBuilder::new(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentCompactIntVecBuilder::new(self.n, &path)?;
b.inc_present(src.view());
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
// ── Helpers ───────────────────────────────────────────────────────────────────
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
}
impl MatrixGroupOps for PersistentCompactIntMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec> {
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn fill_symmetric<T>(n: usize, vals: impl Iterator<Item = (usize, usize, T, T)>) -> Array2<T>
where T: Clone + Default {
let mut m = Array2::from_elem((n, n), T::default());
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices { result.add(self.col_view(c)); }
result.freeze()
}
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or_where(self.col_view(c), |v| v >= threshold);
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.add(self.col_view(first));
for &c in rest { result.min(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices { result.max(self.col_view(c)); }
result.freeze()
}
}
+1 -6
View File
@@ -23,11 +23,6 @@ impl LayerMeta {
}
fn parse(s: &str) -> Option<Self> {
let key = "\"n\":";
let pos = s.find(key)? + key.len();
let rest = s[pos..].trim_start();
let end = rest.find(|c: char| !c.is_ascii_digit()).unwrap_or(rest.len());
let n = rest[..end].parse().ok()?;
Some(Self { n })
Some(Self { n: crate::meta::field(s, "n")? })
}
}
+11 -1
View File
@@ -1,20 +1,30 @@
mod bitvec;
mod bitmatrix;
mod builder;
mod colgroup;
mod format;
mod intmatrix;
mod layer_meta;
mod meta;
mod reader;
mod siblingannex;
mod tempbitvec;
mod tempintvec;
mod views;
pub mod traits;
pub use bitvec::{BitIter, PersistentBitVec, PersistentBitVecBuilder};
pub use bitmatrix::{PersistentBitMatrix, PersistentBitMatrixBuilder, pack_bit_matrix};
pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta;
pub use reader::PersistentCompactIntVec;
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
pub use traits::{BitPartials, ColumnWeights, CountPartials};
pub use views::{BitSliceView, BitSliceIter, IntSliceView, IntSliceViewIter};
#[cfg(test)]
#[path = "tests/mod.rs"]
+1 -1
View File
@@ -23,7 +23,7 @@ fn parse(s: &str) -> Option<MatrixMeta> {
Some(MatrixMeta { n: field(s, "n")?, n_cols: field(s, "n_cols")? })
}
fn field(s: &str, name: &str) -> Option<usize> {
pub(crate) fn field(s: &str, name: &str) -> Option<usize> {
let key = format!("\"{}\":", name);
let pos = s.find(&key)? + key.len();
let rest = s[pos..].trim_start();
+73 -210
View File
@@ -4,7 +4,8 @@ use std::path::{Path, PathBuf};
use memmap2::Mmap;
use crate::format::{HEADER_SIZE, INDEX_ENTRY_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE};
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE, parse_index_entry};
use crate::views::IntSliceView;
pub struct PersistentCompactIntVec {
mmap: Mmap,
@@ -18,100 +19,60 @@ pub struct PersistentCompactIntVec {
}
impl PersistentCompactIntVec {
/// Opens a persistent compact int vector from the given path.
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(
io::ErrorKind::InvalidData,
"PCIV file too short",
));
return Err(io::Error::new(io::ErrorKind::InvalidData, "PCIV file too short"));
}
if &mmap[0..4] != &MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PCIV magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let n_index = u64::from_le_bytes(mmap[24..32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[32..40].try_into().unwrap()) as usize;
let n_index = u64::from_le_bytes(mmap[24..32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[32..40].try_into().unwrap()) as usize;
let primary_offset = HEADER_SIZE;
let data_offset = primary_offset + n;
let index_offset = data_offset + n_overflow * OVERFLOW_ENTRY_SIZE;
let data_offset = primary_offset + n;
let index_offset = data_offset + n_overflow * OVERFLOW_ENTRY_SIZE;
let mut index = Vec::with_capacity(n_index);
for i in 0..n_index {
let off = index_offset + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[off..off + 8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(mmap[off + 8..off + 16].try_into().unwrap()) as usize;
index.push((slot, pos));
index.push(parse_index_entry(&mmap, index_offset, i));
}
Ok(Self {
mmap,
n,
n_overflow,
step,
index,
primary_offset,
data_offset,
path: path.to_path_buf(),
})
Ok(Self { mmap, n, n_overflow, step, index, primary_offset, data_offset, path: path.to_path_buf() })
}
/// Returns the path of the compact int vector file.
pub fn path(&self) -> &Path {
&self.path
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// Returns the length of the compact int vector.
pub fn len(&self) -> usize {
self.n
}
/// Returns whether the compact int vector is empty.
pub fn is_empty(&self) -> bool {
self.n == 0
}
/// Returns the value at the given slot.
pub fn get(&self, slot: usize) -> u32 {
match self.mmap[self.primary_offset + slot] {
255 => self.overflow_get(slot),
v => v as u32,
v => v as u32,
}
}
/// Returns the value at the given slot from the overflow region.
fn overflow_get(&self, slot: usize) -> u32 {
let pos_start;
let pos_end;
if self.step == 0 {
pos_start = 0;
pos_end = self.n_overflow;
let (pos_start, pos_end) = if self.step == 0 {
(0, self.n_overflow)
} else {
let i = self
.index
.partition_point(|&(s, _)| s <= slot)
.saturating_sub(1);
pos_start = self.index[i].1;
pos_end = if i + 1 < self.index.len() {
self.index[i + 1].1
} else {
self.n_overflow
};
}
let i = self.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
let start = self.index[i].1;
let end = if i + 1 < self.index.len() { self.index[i + 1].1 } else { self.n_overflow };
(start, end)
};
let mut lo = pos_start;
let mut hi = pos_end;
while lo < hi {
let mid = lo + (hi - lo) / 2;
match self.data_slot(mid).cmp(&slot) {
std::cmp::Ordering::Equal => return self.data_value(mid),
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Equal => return self.data_value(mid),
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Greater => hi = mid,
}
}
@@ -119,140 +80,91 @@ impl PersistentCompactIntVec {
}
#[inline]
/// Returns the slot at the given index in the overflow region.
fn data_slot(&self, i: usize) -> usize {
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE;
u64::from_le_bytes(self.mmap[off..off + 8].try_into().unwrap()) as usize
}
#[inline]
/// Returns the value at the given index in the overflow region.
fn data_value(&self, i: usize) -> u32 {
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE + 8;
u32::from_le_bytes(self.mmap[off..off + 4].try_into().unwrap())
}
#[inline]
/// Returns the sum of all values in the compact int vector.
pub fn sum(&self) -> u64 {
self.iter().map(|v| v as u64).sum()
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
byte_sum(primary, (0..self.n_overflow).map(|i| self.data_value(i)))
}
#[inline]
/// Returns the Bray-Curtis distance between two compact int vectors.
pub fn count_nonzero(&self) -> u64 {
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
byte_count_nonzero(primary)
}
/// Lightweight zero-copy view — primary and overflow point into the mmap.
pub fn view(&self) -> IntSliceView<'_> {
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
let overflow_raw = &self.mmap[self.data_offset..self.data_offset + self.n_overflow * OVERFLOW_ENTRY_SIZE];
IntSliceView::new(primary, overflow_raw, self.n_overflow, self.n)
}
pub fn iter(&self) -> Iter<'_> {
Iter { pciv: self, slot: 0, overflow_pos: 0 }
}
// ── Distance methods ──────────────────────────────────────────────────────
pub fn bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
let sum_min = self.partial_bray_dist(other);
let denom = self.sum() + other.sum();
if denom == 0 {
return 0.0;
}
1.0 - 2.0 * sum_min as f64 / denom as f64
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
}
/// Returns `Σ_slot min(self[slot], other[slot])` — the additive numerator of Bray-Curtis.
/// The denominator `sum_a + sum_b` is obtained from `self.sum() + other.sum()`.
pub fn partial_bray_dist(&self, other: &PersistentCompactIntVec) -> u64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
.map(|(a, b)| a.min(b) as u64)
.sum()
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
}
/// Returns the relative frequency Bray-Curtis distance between two compact int vectors.
///
/// This is a variant of [`bray_dist`] that uses relative frequencies instead of raw counts.
pub fn relfreq_bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
let sum_min = self.partial_relfreq_bray_dist(other, sum_a, sum_b);
1.0 - sum_min
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
}
/// Returns the partial relative frequency Bray-Curtis distance between two compact int vectors.
///
/// This is used internally by [`relfreq_bray_dist`] and to easily compute the relative frequency
/// Bray-Curtis distance over a set of vector pairs.
///
/// Arguments:
/// - `other`: the other compact int vector to compare with
/// - `sum_a`: the sum of the first vector's counts
/// - `sum_b`: the sum of the second vector's counts
///
/// Returns the sum of the minimum relative frequencies at each index.
pub fn partial_relfreq_bray_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_relfreq_bray_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_min: f64 = self
.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
pa.min(pb)
})
.sum();
sum_min
.sum()
}
/// Returns the euclidean distance between two compact int vectors.
pub fn euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
self.partial_euclidean_dist(other).sqrt()
}
/// Returns the partial euclidean distance between two compact int vectors.
///
/// This is used internally by [`euclidean_dist`] and to easily compute the euclidean distance
/// over a set of vector pairs.
///
/// The result is the sum of the squared differences between corresponding elements of the two
/// vectors.
pub fn partial_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
.map(|(a, b)| {
let d = a as f64 - b as f64;
d * d
})
self.iter().zip(other.iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
.sum()
}
/// Returns the relative frequency euclidean distance between two compact int vectors.
///
/// This is a variant of [`euclidean_dist`] that uses relative frequencies instead of raw counts.
pub fn relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
self.partial_relfreq_euclidean_dist(other, sum_a, sum_b)
.sqrt()
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
}
/// Returns the partial relative frequency euclidean distance between two compact int vectors.
///
/// This is used internally by [`relfreq_euclidean_dist`] and to easily compute the relative frequency
/// euclidean distance over a set of vector pairs.
pub fn partial_relfreq_euclidean_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
@@ -262,46 +174,19 @@ impl PersistentCompactIntVec {
.sum()
}
/// Returns the Euclidean distance between two compact int vectors using the Hellinger transform.
///
/// The Hellinger transform is applied to the raw counts of each vector, and the result is
/// the Euclidean distance between the transformed vectors. The Hellinger transform is defined
/// as the square root of the relative frequencies.
pub fn hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
self.partial_hellinger_euclidean_dist(other, sum_a, sum_b)
.sqrt()
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
}
/// Returns the partial Hellinger Euclidean distance between two compact int vectors.
///
/// This is used internally by [`hellinger_euclidean_dist`] and to easily compute the Hellinger
/// Euclidean distance over a set of vector pairs.
pub fn partial_hellinger_euclidean_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 {
(a as f64 / sum_a).sqrt()
} else {
0.0
};
let pb = if sum_b > 0.0 {
(b as f64 / sum_b).sqrt()
} else {
0.0
};
let pa = if sum_a > 0.0 { (a as f64 / sum_a).sqrt() } else { 0.0 };
let pb = if sum_b > 0.0 { (b as f64 / sum_b).sqrt() } else { 0.0 };
let d = pa - pb;
d * d
})
@@ -313,22 +198,13 @@ impl PersistentCompactIntVec {
}
pub fn threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let (intersection, union) = self.partial_threshold_jaccard_dist(other, threshold);
if union == 0 {
return 0.0;
}
1.0 - intersection as f64 / union as f64
if union == 0 { 0.0 } else { 1.0 - intersection as f64 / union as f64 }
}
pub fn partial_threshold_jaccard_dist(
&self,
other: &PersistentCompactIntVec,
threshold: u32,
) -> (u64, u64) {
pub fn partial_threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> (u64, u64) {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= threshold;
let bp = b >= threshold;
@@ -339,23 +215,12 @@ impl PersistentCompactIntVec {
pub fn jaccard_dist(&self, other: &PersistentCompactIntVec) -> f64 {
self.threshold_jaccard_dist(other, 1)
}
pub fn iter(&self) -> Iter<'_> {
Iter {
pciv: self,
slot: 0,
overflow_pos: 0,
}
}
}
impl<'a> IntoIterator for &'a PersistentCompactIntVec {
type Item = u32;
type IntoIter = Iter<'a>;
fn into_iter(self) -> Iter<'a> {
self.iter()
}
fn into_iter(self) -> Iter<'a> { self.iter() }
}
pub struct Iter<'a> {
@@ -370,9 +235,7 @@ impl Iterator for Iter<'_> {
type Item = u32;
fn next(&mut self) -> Option<u32> {
if self.slot >= self.pciv.n {
return None;
}
if self.slot >= self.pciv.n { return None; }
let v = self.pciv.mmap[self.pciv.primary_offset + self.slot];
self.slot += 1;
if v < 255 {
+245
View File
@@ -0,0 +1,245 @@
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
//! derived value used by the central-position SNP distance estimator (see
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
//! family, and the canonical form of a family").
//!
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
//! k-mers sharing the same flanks, differing only at the central base):
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
//! for a single nucleotide) is set iff the family member whose *own* central
//! base — in its own canonical orientation — is `b`, is observed anywhere in
//! the current multi-genome index. This is a property of the whole index,
//! not of any one genome.
//!
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
//! derived from the mask instead, not stored:
//! - sibling count = `popcount(mask) - 1`;
//! - minorant = regenerate the family's 4 canonical forms from the slot's
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
//! lookup), compare the raw encodings of whichever are set in the mask,
//! take the smallest — see `obikindex::siblings`.
//!
//! Mask value 0 is logically unreachable as a real result (a slot's own base
//! is always present in its own family) and is reused as the "not yet
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
//! real value is only ever written once, by the computation pass.
//!
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
//! bits/slot): correctness and simplicity first, for a first implementation.
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
//! behavioural change, left for later.
use std::fs::{File, OpenOptions};
use std::io;
use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
const MAGIC: [u8; 4] = *b"PSIB";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
const HEADER_SIZE: usize = 16;
/// A family presence mask: bit `b` set iff the member whose own canonical
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
pub struct FamilyMask(u8);
impl FamilyMask {
/// The empty mask — never a valid *computed* result (a slot's own base
/// is always present in its own family) — used only to build up a mask
/// via repeated [`with`](Self::with) calls before storing it.
pub const EMPTY: FamilyMask = FamilyMask(0);
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
#[inline]
pub fn with(self, base: u8) -> Self {
debug_assert!(base < 4, "base out of range: {base}");
FamilyMask(self.0 | (1 << base))
}
/// Is the member with central base `base` (0..3) present?
#[inline]
pub fn has(self, base: u8) -> bool {
debug_assert!(base < 4, "base out of range: {base}");
self.0 & (1 << base) != 0
}
/// Number of family members observed anywhere in the index (1..=4).
#[inline]
pub fn family_size(self) -> u32 {
self.0.count_ones()
}
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
#[inline]
pub fn siblings(self) -> u32 {
self.family_size() - 1
}
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
/// a mask via their own bit operations (e.g. concurrently, via an
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
#[inline]
pub fn bits(self) -> u8 {
self.0
}
/// Construct from a raw bitmask (only the low 4 bits are kept).
#[inline]
pub fn from_bits(bits: u8) -> Self {
FamilyMask(bits & 0b1111)
}
#[inline]
fn encode(self) -> u8 {
self.0
}
#[inline]
fn decode(byte: u8) -> Option<Self> {
if byte == 0 {
// Unreachable for a real result — reserved as the "not yet
// computed" sentinel.
return None;
}
Some(FamilyMask(byte & 0b1111))
}
}
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
pub struct SiblingAnnex {
mmap: Mmap,
n: usize,
path: PathBuf,
}
impl SiblingAnnex {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
}
if mmap[0..4] != MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
if mmap.len() < HEADER_SIZE + n {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// `None` means the slot has not (yet) been computed — see module docs.
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
}
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
pub struct SiblingAnnexBuilder {
mmap: MmapMut,
n: usize,
path: PathBuf,
}
impl SiblingAnnexBuilder {
/// Create a new annex of `n` slots at `path`, pre-initialised to the
/// "not yet computed" sentinel (all-zero).
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n;
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[4..8].copy_from_slice(&[0u8; 4]);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
// Data region left at 0 by `set_len`/mmap — the sentinel value.
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
// Redundant concurrent writes from independent recomputation paths
// converge to the same encoded byte for a given slot, so a plain
// store here is safe even without external synchronisation, as long
// as the byte write itself is atomic (true for a single aligned
// byte on every platform this project targets).
self.mmap[HEADER_SIZE + slot] = mask.encode();
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<SiblingAnnex> {
let path = self.path.clone();
self.close()?;
SiblingAnnex::open(&path)
}
}
#[cfg(test)]
mod tests {
use super::*;
use tempfile::tempdir;
#[test]
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
for slot in 0..4 {
assert_eq!(builder.get(slot), None);
}
builder.close().unwrap();
}
#[test]
fn roundtrip_all_valid_masks() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
let masks = [
FamilyMask::EMPTY.with(0), // just A: family size 1
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
];
for (slot, mask) in masks.iter().enumerate() {
builder.set(slot, *mask);
}
let annex = builder.finish().unwrap();
for (slot, mask) in masks.iter().enumerate() {
assert_eq!(annex.get(slot), Some(*mask));
}
assert_eq!(annex.get(0).unwrap().siblings(), 0);
assert_eq!(annex.get(1).unwrap().siblings(), 1);
assert_eq!(annex.get(2).unwrap().siblings(), 2);
assert_eq!(annex.get(3).unwrap().siblings(), 3);
assert_eq!(annex.get(3).unwrap().family_size(), 4);
}
#[test]
fn has_reflects_individual_bits() {
let mask = FamilyMask::EMPTY.with(0).with(2);
assert!(mask.has(0));
assert!(!mask.has(1));
assert!(mask.has(2));
assert!(!mask.has(3));
}
}
+111
View File
@@ -0,0 +1,111 @@
use std::io;
use std::path::Path;
use tempfile::TempDir;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
// ── TempBitVec — frozen read-only, auto-deleted on drop ──────────────────────
pub struct TempBitVec {
vec: PersistentBitVec,
// Dropped after `vec` (field order), so the mmap is released before the
// temp directory is deleted.
_temp: TempDir,
}
impl TempBitVec {
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentBitVec> {
std::fs::copy(self.vec.path(), path)?;
PersistentBitVec::open(path)
}
pub fn len(&self) -> usize {
self.vec.len()
}
pub fn is_empty(&self) -> bool {
self.vec.is_empty()
}
pub fn get(&self, slot: usize) -> bool {
self.vec.get(slot)
}
pub fn count_ones(&self) -> u64 {
self.vec.count_ones()
}
pub fn view(&self) -> BitSliceView<'_> {
self.vec.view()
}
pub fn iter(&self) -> BitSliceIter<'_> {
self.view().iter()
}
}
// ── TempBitVecBuilder — mutable, becomes TempBitVec on freeze ────────────────
pub struct TempBitVecBuilder {
builder: PersistentBitVecBuilder,
temp: TempDir,
}
impl TempBitVecBuilder {
pub fn new(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pbiv");
let builder = PersistentBitVecBuilder::new(n, &path)?;
Ok(Self { builder, temp })
}
pub fn new_ones(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pbiv");
let builder = PersistentBitVecBuilder::new_ones(n, &path)?;
Ok(Self { builder, temp })
}
pub fn freeze(self) -> io::Result<TempBitVec> {
let Self { builder, temp } = self;
let vec = builder.finish()?;
Ok(TempBitVec { vec, _temp: temp })
}
pub fn set(&mut self, slot: usize, value: bool) {
self.builder.set(slot, value);
}
pub fn view(&self) -> BitSliceView<'_> {
self.builder.view()
}
pub fn or(&mut self, other: BitSliceView<'_>) {
self.builder.or(other);
}
pub fn and(&mut self, other: BitSliceView<'_>) {
self.builder.and(other);
}
pub fn xor(&mut self, other: BitSliceView<'_>) {
self.builder.xor(other);
}
pub fn not(&mut self) {
self.builder.not();
}
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
self.builder.copy_from(src);
}
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.or_where(col, pred);
}
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.and_where(col, pred);
}
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.xor_where(col, pred);
}
}
+89
View File
@@ -0,0 +1,89 @@
use std::io;
use std::path::Path;
use tempfile::TempDir;
use crate::builder::PersistentCompactIntVecBuilder;
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceView, IntSliceView};
// ── TempCompactIntVec — frozen read-only, auto-deleted on drop ────────────────
pub struct TempCompactIntVec {
vec: PersistentCompactIntVec,
// Dropped after `vec` (field order), so the mmap is released before the
// temp directory is deleted.
_temp: TempDir,
}
impl TempCompactIntVec {
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentCompactIntVec> {
std::fs::copy(self.vec.path(), path)?;
PersistentCompactIntVec::open(path)
}
pub fn len(&self) -> usize { self.vec.len() }
pub fn is_empty(&self) -> bool { self.vec.is_empty() }
pub fn get(&self, slot: usize) -> u32 { self.vec.get(slot) }
pub fn sum(&self) -> u64 { self.vec.sum() }
pub fn view(&self) -> IntSliceView<'_> { self.vec.view() }
pub fn iter(&self) -> crate::reader::Iter<'_> { self.vec.iter() }
}
// ── TempCompactIntVecBuilder — mutable, becomes TempCompactIntVec on freeze ──
pub struct TempCompactIntVecBuilder {
builder: PersistentCompactIntVecBuilder,
temp: TempDir,
}
impl TempCompactIntVecBuilder {
pub fn new(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pciv");
let builder = PersistentCompactIntVecBuilder::new(n, &path)?;
Ok(Self { builder, temp })
}
pub fn freeze(self) -> io::Result<TempCompactIntVec> {
let Self { builder, temp } = self;
let vec = builder.finish()?;
Ok(TempCompactIntVec { vec, _temp: temp })
}
pub fn n(&self) -> usize { self.builder.len() }
pub fn set(&mut self, slot: usize, value: u32) { self.builder.set(slot, value); }
pub fn get(&self, slot: usize) -> u32 { self.builder.get(slot) }
pub fn primary_bytes(&self) -> &[u8] { self.builder.primary_bytes() }
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { self.builder.primary_bytes_mut() }
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
self.builder.inc_present(col);
}
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
self.builder.inc_present_fast(col);
}
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.inc_predicate(col, pred);
}
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.inc_predicate_fast(col, pred);
}
pub fn add(&mut self, other: IntSliceView<'_>) {
self.builder.add(other);
}
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
self.builder.mask_with(mask);
}
pub fn min(&mut self, other: IntSliceView<'_>) { self.builder.min(other); }
pub fn max(&mut self, other: IntSliceView<'_>) { self.builder.max(other); }
pub fn diff(&mut self, other: IntSliceView<'_>) { self.builder.diff(other); }
}
+55 -1
View File
@@ -1,6 +1,6 @@
use tempfile::tempdir;
use crate::{PersistentBitMatrix, PersistentBitMatrixBuilder};
use crate::{pack_bit_matrix, PersistentBitMatrix, PersistentBitMatrixBuilder};
use crate::traits::BitPartials;
fn make_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
@@ -203,3 +203,57 @@ fn partial_hamming_matches_hamming() {
let full = m.hamming_dist_matrix();
assert_eq!(partial, full);
}
// ── col_view on Packed ────────────────────────────────────────────────────────
#[test]
fn col_view_packed_values() {
let (dir, _) = make_matrix(&[
&[true, false, true, true],
&[false, true, false, true],
]);
pack_bit_matrix(&dir.path().join("presence")).unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
// col 0: [T, F, T, T]
let v0 = m.col_view(0);
assert_eq!(v0.len(), 4);
assert_eq!(v0.get(0), true);
assert_eq!(v0.get(1), false);
assert_eq!(v0.get(2), true);
assert_eq!(v0.get(3), true);
assert_eq!(v0.count_ones(), 3);
// col 1: [F, T, F, T]
let v1 = m.col_view(1);
assert_eq!(v1.get(0), false);
assert_eq!(v1.get(1), true);
assert_eq!(v1.get(2), false);
assert_eq!(v1.get(3), true);
assert_eq!(v1.count_ones(), 2);
}
#[test]
fn col_view_packed_matches_columnar() {
let data: &[&[bool]] = &[
&[true, false, true, false, true, true, false, true],
&[false, false, true, true, false, true, true, false],
&[true, true, true, false, false, false, true, true],
];
let (dir_col, m_col) = make_matrix(data);
let (dir_pack, _) = make_matrix(data);
pack_bit_matrix(&dir_pack.path().join("presence")).unwrap();
let m_pack = PersistentBitMatrix::open(dir_pack.path()).unwrap();
for c in 0..data.len() {
let col_ref = m_col.col(c);
let col_view = m_pack.col_view(c);
assert_eq!(col_view.len(), col_ref.len(), "col={c} len");
for s in 0..col_ref.len() {
assert_eq!(col_view.get(s), col_ref.get(s), "col={c} slot={s}");
}
assert_eq!(col_view.count_ones(), col_ref.count_ones(), "col={c} count_ones");
assert_eq!(col_view.words(), col_ref.words(), "col={c} words");
}
drop(dir_col);
}
+3 -3
View File
@@ -77,7 +77,7 @@ fn op_and() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.and(&rb);
b.and(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, false, false, false]);
@@ -90,7 +90,7 @@ fn op_or() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.or(&rb);
b.or(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, true, true, false]);
@@ -103,7 +103,7 @@ fn op_xor() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.xor(&rb);
b.xor(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![false, true, true, false]);
+223
View File
@@ -0,0 +1,223 @@
use tempfile::tempdir;
use crate::{
ColGroup, MatrixGroupOps,
PersistentBitMatrix, PersistentBitMatrixBuilder,
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
};
use crate::{PersistentBitVecBuilder, PersistentCompactIntVec, PersistentCompactIntVecBuilder};
// ── helpers ───────────────────────────────────────────────────────────────────
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentCompactIntMatrixBuilder::new(n, &dir.path().join("counts")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
(dir, m)
}
fn make_bit_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let presence = dir.path().join("presence");
let mut b = PersistentBitMatrixBuilder::new(n, &presence).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
(dir, m)
}
// ── IntMatrix: partial_group_sum ──────────────────────────────────────────────
#[test]
fn int_partial_group_sum_basic() {
// col0=[1,2,3], col1=[10,20,30], col2=[100,0,5]
// group {0,2}: sum = [101, 2, 8]
let (_d, m) = make_int_matrix(&[&[1, 2, 3], &[10, 20, 30], &[100, 0, 5]]);
let g = ColGroup::new("g", vec![0, 2]);
let result = m.partial_group_sum(&g).unwrap();
assert_eq!(result.get(0), 101);
assert_eq!(result.get(1), 2);
assert_eq!(result.get(2), 8);
}
#[test]
fn int_partial_group_sum_with_overflow() {
// col0=[300,0], col1=[200,400]: group {0,1}: sum=[500, 400]
let (_d, m) = make_int_matrix(&[&[300, 0], &[200, 400]]);
let g = ColGroup::new("g", vec![0, 1]);
let result = m.partial_group_sum(&g).unwrap();
assert_eq!(result.get(0), 500);
assert_eq!(result.get(1), 400);
assert_eq!(result.sum(), 900);
}
// ── IntMatrix: partial_group_presence_count ───────────────────────────────────
#[test]
fn int_partial_group_presence_count() {
// col0=[5,1,0,3], col1=[2,0,4,3], col2=[0,3,1,0]
// threshold=2: col0: [T,F,F,T], col1: [T,F,T,T], col2: [F,T,F,F]
// group {0,1,2}: counts = [2, 1, 1, 2]
let (_d, m) = make_int_matrix(&[&[5, 1, 0, 3], &[2, 0, 4, 3], &[0, 3, 1, 0]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 2).unwrap();
assert_eq!(result.get(0), 2);
assert_eq!(result.get(1), 1);
assert_eq!(result.get(2), 1);
assert_eq!(result.get(3), 2);
}
#[test]
fn int_partial_group_presence_count_with_overflow() {
// col0=[300,0,10], col1=[0,400,10], col2=[1,1,10]
// threshold=5: col0: [T,F,T], col1: [F,T,T], col2: [F,F,T]
// group {0,1,2}: counts = [1, 1, 3]
let (_d, m) = make_int_matrix(&[&[300, 0, 10], &[0, 400, 10], &[1, 1, 10]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 5).unwrap();
assert_eq!(result.get(0), 1);
assert_eq!(result.get(1), 1);
assert_eq!(result.get(2), 3);
}
// ── IntMatrix: partial_group_any ──────────────────────────────────────────────
#[test]
fn int_partial_group_any() {
// col0=[0,3,0,1], col1=[2,0,0,0], col2=[0,0,5,0]
// threshold=2: col0: [F,T,F,F], col1: [T,F,F,F], col2: [F,F,T,F]
// group {0,1,2}: any = [T, T, T, F]
let (_d, m) = make_int_matrix(&[&[0, 3, 0, 1], &[2, 0, 0, 0], &[0, 0, 5, 0]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_any(&g, 2).unwrap();
assert_eq!(result.get(0), true);
assert_eq!(result.get(1), true);
assert_eq!(result.get(2), true);
assert_eq!(result.get(3), false);
}
// ── IntMatrix: mask_with ──────────────────────────────────────────────────────
#[test]
fn mask_with_zeros_selected_slots() {
// count vec [10, 20, 30, 40], mask [T, F, T, F] → [10, 0, 30, 0]
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
v.set(0, 10); v.set(1, 20); v.set(2, 30); v.set(3, 40);
let mut mask = PersistentBitVecBuilder::new(4, &dir.path().join("m.pbiv")).unwrap();
mask.set(0, true); mask.set(2, true);
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 10);
assert_eq!(r.get(1), 0);
assert_eq!(r.get(2), 30);
assert_eq!(r.get(3), 0);
}
#[test]
fn mask_with_overflow_slot_zeroed() {
// overflow slot (value 500) masked out → removed from overflow, primary=0
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(3, &dir.path().join("v.pciv")).unwrap();
v.set(0, 10); v.set(1, 500); v.set(2, 5);
let mut mask = PersistentBitVecBuilder::new(3, &dir.path().join("m.pbiv")).unwrap();
mask.set(0, true); mask.set(2, true); // slot 1 masked out
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 10);
assert_eq!(r.get(1), 0);
assert_eq!(r.get(2), 5);
let ov: Vec<_> = r.view().overflow_entries().collect();
assert!(ov.is_empty(), "overflow entry for masked-out slot should be gone");
}
#[test]
fn mask_with_all_ones_is_noop() {
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
v.set(0, 300); v.set(1, 1); v.set(2, 0); v.set(3, 42);
let mask = PersistentBitVecBuilder::new_ones(4, &dir.path().join("m.pbiv")).unwrap();
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 300);
assert_eq!(r.get(1), 1);
assert_eq!(r.get(2), 0);
assert_eq!(r.get(3), 42);
}
// ── BitMatrix: partial_group_presence_count ───────────────────────────────────
#[test]
fn bit_partial_group_presence_count() {
// col0=[T,F,T,F], col1=[T,T,F,F], col2=[F,T,T,F]
// group {0,1,2}: counts = [2, 2, 2, 0]
let (_d, m) = make_bit_matrix(&[
&[true, false, true, false],
&[true, true, false, false],
&[false,true, true, false],
]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 1).unwrap();
assert_eq!(result.get(0), 2);
assert_eq!(result.get(1), 2);
assert_eq!(result.get(2), 2);
assert_eq!(result.get(3), 0);
}
// ── BitMatrix: partial_group_any ──────────────────────────────────────────────
#[test]
fn bit_partial_group_any() {
// col0=[T,F,F], col1=[F,F,T], group {0,1}: any = [T, F, T]
let (_d, m) = make_bit_matrix(&[
&[true, false, false],
&[false, false, true],
]);
let g = ColGroup::new("g", vec![0, 1]);
let result = m.partial_group_any(&g, 1).unwrap();
assert_eq!(result.get(0), true);
assert_eq!(result.get(1), false);
assert_eq!(result.get(2), true);
}
// ── Composition: partial results are additive ─────────────────────────────────
#[test]
fn int_presence_count_additive_across_split() {
// Simulate two partitions (different kmer ranges) whose counts should add.
// Global data for col0: [5,1,0,3,2], col1: [2,0,4,3,1] — threshold=2
// Split: partition A = slots 0..2, partition B = slots 2..5
let data_a: &[&[u32]] = &[&[5, 1], &[2, 0]];
let data_b: &[&[u32]] = &[&[0, 3, 2], &[4, 3, 1]];
let (_da, ma) = make_int_matrix(data_a);
let (_db, mb) = make_int_matrix(data_b);
let g = ColGroup::new("g", vec![0, 1]);
let pa = ma.partial_group_presence_count(&g, 2).unwrap();
let pb = mb.partial_group_presence_count(&g, 2).unwrap();
// Concatenate by adding (disjoint kmer ranges — here we just verify
// individual results match the expected per-partition counts).
// partition A: col0=[5≥2,1<2]=[T,F], col1=[2≥2,0<2]=[T,F] → [2, 0]
assert_eq!(pa.get(0), 2);
assert_eq!(pa.get(1), 0);
// partition B: col0=[0<2,3≥2,2≥2]=[F,T,T], col1=[4≥2,3≥2,1<2]=[T,T,F] → [1, 2, 1]
assert_eq!(pb.get(0), 1);
assert_eq!(pb.get(1), 2);
assert_eq!(pb.get(2), 1);
}
+56 -1
View File
@@ -1,6 +1,6 @@
use tempfile::tempdir;
use crate::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
use crate::{pack_compact_int_matrix, PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
use crate::traits::CountPartials;
fn make_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
@@ -243,6 +243,61 @@ fn partial_hellinger_matches_full() {
}
}
#[test]
fn col_view_packed_values() {
// Build Columnar with overflow values (≥ 255), pack, reopen as Packed, exercise col_view().
let (dir, _col) = make_matrix(&[&[10, 300, 500], &[200, 50, 1000]]);
pack_compact_int_matrix(&dir.path().join("counts")).unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
// col 0: [10, 300, 500] — two overflow slots
let v0 = m.col_view(0);
assert_eq!(v0.get(0), 10);
assert_eq!(v0.get(1), 300);
assert_eq!(v0.get(2), 500);
assert_eq!(v0.sum(), 810);
assert_eq!(v0.count_nonzero(), 3);
let mut ov0: Vec<(usize, u32)> = v0.overflow_entries().collect();
ov0.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov0, vec![(1, 300), (2, 500)]);
// col 1: [200, 50, 1000] — one overflow slot
let v1 = m.col_view(1);
assert_eq!(v1.get(0), 200);
assert_eq!(v1.get(1), 50);
assert_eq!(v1.get(2), 1000);
let mut ov1: Vec<(usize, u32)> = v1.overflow_entries().collect();
ov1.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov1, vec![(2, 1000)]);
}
#[test]
fn col_view_packed_matches_columnar() {
// Same data, compare col_view() on Packed against col() on Columnar slot-by-slot.
let data: &[&[u32]] = &[&[0, 255, 1, 300, 128], &[500, 3, 0, 700, 42]];
let (dir_col, m_col) = make_matrix(data);
// Re-build in a separate dir so we can pack without touching m_col's files.
let (dir_pack, _) = make_matrix(data);
pack_compact_int_matrix(&dir_pack.path().join("counts")).unwrap();
let m_pack = PersistentCompactIntMatrix::open(dir_pack.path()).unwrap();
for c in 0..data.len() {
let col_ref = m_col.col(c);
let col_view = m_pack.col_view(c);
assert_eq!(col_view.len(), col_ref.len());
for s in 0..col_ref.len() {
assert_eq!(col_view.get(s), col_ref.get(s), "col={c} slot={s}");
}
assert_eq!(col_view.sum(), col_ref.sum(), "col={c} sum");
let mut ov_view: Vec<(usize, u32)> = col_view.overflow_entries().collect();
let mut ov_ref: Vec<(usize, u32)> = col_ref.view().overflow_entries().collect();
ov_view.sort_unstable_by_key(|&(s, _)| s);
ov_ref.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov_view, ov_ref, "col={c} overflow_entries");
}
drop(dir_col);
}
#[test]
fn partial_relfreq_bray_additive_across_split() {
// Split rows [1,2,3,4,5] between two matrices; partial sums should add up.
+5 -4
View File
@@ -1,5 +1,6 @@
mod bitmatrix;
mod bitvec;
mod colgroup;
mod intmatrix;
use tempfile::tempdir;
@@ -169,7 +170,7 @@ fn combine_min() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.min(&rb);
b.min(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 100, 0, 800]);
@@ -182,7 +183,7 @@ fn combine_max() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.max(&rb);
b.max(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![20, 300, 500, 1000]);
@@ -195,7 +196,7 @@ fn combine_add() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.add(&rb);
b.add(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![30, 300, 5, 101]);
@@ -220,7 +221,7 @@ fn combine_diff() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.diff(&rb);
b.diff(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 700, 0, 0]);
+32 -1
View File
@@ -1,9 +1,28 @@
use ndarray::{Array1, Array2};
/// Column-level weight statistic — total count or presence count per column.
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
/// https://mash.readthedocs.io/en/latest/distances.html:
/// `D = -1/k * ln(2J / (1+J))`.
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
d_jaccard.mapv(|d| {
let j = 1.0 - d;
if j <= 0.0 { 1.0 }
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
})
}
// ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances.
///
/// `partial_kmer_counts` returns the number of **distinct k-mers** present per
/// column (presence = 1 entries; count > 0 entries). For presence matrices this
/// equals `col_weights`; for count matrices it differs (count_nonzero vs sum).
pub trait ColumnWeights: Send + Sync {
fn col_weights(&self) -> Array1<u64>;
fn partial_kmer_counts(&self) -> Array1<u64> {
self.col_weights()
}
}
/// Partial distance matrices for count-based data (`PersistentCompactIntMatrix`).
@@ -66,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the presence-threshold Jaccard distance.
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
}
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights();
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
@@ -118,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the Jaccard distance.
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
}
fn hamming_dist_matrix(&self) -> Array2<u64> {
self.partial_hamming()
}
+278
View File
@@ -0,0 +1,278 @@
use crate::format::{byte_count_nonzero, byte_sum, parse_overflow_entry};
// ── BitSliceView ──────────────────────────────────────────────────────────────
/// Lightweight, copy-able read-only view over a u64 word array.
/// Bit `i` is in `words[i >> 6]` at position `i & 63`. Padding bits are zero.
#[derive(Clone, Copy)]
pub struct BitSliceView<'a> {
pub(crate) words: &'a [u64],
pub(crate) n: usize,
}
impl<'a> BitSliceView<'a> {
#[inline]
pub fn new(words: &'a [u64], n: usize) -> Self { Self { words, n } }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn words(&self) -> &'a [u64] { self.words }
#[inline]
pub fn get(&self, slot: usize) -> bool {
(self.words[slot >> 6] >> (slot & 63)) & 1 != 0
}
pub fn count_ones(&self) -> u64 {
self.words.iter().map(|w| w.count_ones() as u64).sum()
}
pub fn count_zeros(&self) -> u64 { self.n as u64 - self.count_ones() }
pub fn iter(&self) -> BitSliceIter<'a> {
BitSliceIter { words: self.words, slot: 0, n: self.n }
}
pub fn partial_jaccard_dist(self, other: BitSliceView<'_>) -> (u64, u64) {
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
self.words.iter().zip(other.words)
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
(i + (a & b).count_ones() as u64, u + (a | b).count_ones() as u64)
})
}
pub fn jaccard_dist(self, other: BitSliceView<'_>) -> f64 {
let (inter, union) = self.partial_jaccard_dist(other);
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
}
pub fn hamming_dist(self, other: BitSliceView<'_>) -> u64 {
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
self.words.iter().zip(other.words)
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
.sum()
}
}
// ── BitSliceIter ──────────────────────────────────────────────────────────────
pub struct BitSliceIter<'a> {
words: &'a [u64],
slot: usize,
n: usize,
}
impl Iterator for BitSliceIter<'_> {
type Item = bool;
fn next(&mut self) -> Option<bool> {
if self.slot >= self.n { return None; }
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
self.slot += 1;
Some(v)
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
impl ExactSizeIterator for BitSliceIter<'_> {}
// ── IntSliceView ──────────────────────────────────────────────────────────────
/// Lightweight, copy-able read-only view over a compact-int primary array plus
/// its sorted raw overflow bytes. Zero-copy: all data lives in the caller's mmap.
#[derive(Clone, Copy)]
pub struct IntSliceView<'a> {
pub(crate) primary: &'a [u8],
pub(crate) overflow_raw: &'a [u8], // n_overflow × OVERFLOW_ENTRY_SIZE bytes, sorted by slot
pub(crate) n_overflow: usize,
pub(crate) n: usize,
}
impl<'a> IntSliceView<'a> {
#[inline]
pub fn new(primary: &'a [u8], overflow_raw: &'a [u8], n_overflow: usize, n: usize) -> Self {
Self { primary, overflow_raw, n_overflow, n }
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn primary_bytes(&self) -> &'a [u8] { self.primary }
pub fn n_overflow(&self) -> usize { self.n_overflow }
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + 'a {
let raw = self.overflow_raw;
let n_ov = self.n_overflow;
(0..n_ov).map(move |i| parse_overflow_entry(raw, 0, i))
}
/// O(log n_overflow) via binary search (overflow is always sorted by slot).
pub fn get(&self, slot: usize) -> u32 {
let b = self.primary[slot];
if b < 255 { return b as u32; }
let mut lo = 0usize;
let mut hi = self.n_overflow;
while lo < hi {
let mid = lo + (hi - lo) / 2;
let (s, v) = parse_overflow_entry(self.overflow_raw, 0, mid);
match s.cmp(&slot) {
std::cmp::Ordering::Equal => return v,
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Greater => hi = mid,
}
}
panic!("slot {slot} marked overflow but not found")
}
/// Sequential merge scan: yields all n values in slot order.
pub fn iter(&self) -> IntSliceViewIter<'a> {
IntSliceViewIter {
primary: self.primary,
overflow_raw: self.overflow_raw,
slot: 0,
overflow_pos: 0,
n: self.n,
}
}
pub fn sum(&self) -> u64 {
byte_sum(self.primary, self.overflow_entries().map(|(_, v)| v))
}
pub fn count_nonzero(&self) -> u64 {
byte_count_nonzero(self.primary)
}
// ── Distance methods ──────────────────────────────────────────────────────
pub fn partial_bray_dist(self, other: IntSliceView<'_>) -> u64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
}
pub fn bray_dist(self, other: IntSliceView<'_>) -> f64 {
let sum_min = self.partial_bray_dist(other);
let denom = self.sum() + other.sum();
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
}
pub fn partial_relfreq_bray_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
pa.min(pb)
})
.sum()
}
pub fn relfreq_bray_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
}
pub fn partial_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
.sum()
}
pub fn euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
self.partial_euclidean_dist(other).sqrt()
}
pub fn partial_relfreq_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
let d = pa - pb;
d * d
})
.sum()
}
pub fn relfreq_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
}
pub fn partial_hellinger_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { (a as f64 / sa).sqrt() } else { 0.0 };
let pb = if sb > 0.0 { (b as f64 / sb).sqrt() } else { 0.0 };
let d = pa - pb;
d * d
})
.sum()
}
pub fn hellinger_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
}
pub fn hellinger_dist(self, other: IntSliceView<'_>) -> f64 {
self.hellinger_euclidean_dist(other) / std::f64::consts::SQRT_2
}
pub fn partial_threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> (u64, u64) {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= threshold;
let bp = b >= threshold;
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
})
}
pub fn threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> f64 {
let (inter, union) = self.partial_threshold_jaccard_dist(other, threshold);
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
}
pub fn jaccard_dist(self, other: IntSliceView<'_>) -> f64 {
self.threshold_jaccard_dist(other, 1)
}
}
// ── IntSliceViewIter ──────────────────────────────────────────────────────────
pub struct IntSliceViewIter<'a> {
primary: &'a [u8],
overflow_raw: &'a [u8],
slot: usize,
overflow_pos: usize,
n: usize,
}
impl Iterator for IntSliceViewIter<'_> {
type Item = u32;
fn next(&mut self) -> Option<u32> {
if self.slot >= self.n { return None; }
let v = self.primary[self.slot];
self.slot += 1;
if v < 255 {
Some(v as u32)
} else {
let (_, val) = parse_overflow_entry(self.overflow_raw, 0, self.overflow_pos);
self.overflow_pos += 1;
Some(val)
}
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
impl ExactSizeIterator for IntSliceViewIter<'_> {}
+2 -1
View File
@@ -8,7 +8,8 @@ obikseq = { path = "../obikseq" }
obifastwrite = { path = "../obifastwrite" }
ahash = "0.8"
hashbrown = { version = "0.14", features = ["rayon"] }
rayon = "1"
rayon = "1"
crossbeam-channel = "0.5"
xxhash-rust = { version = "0.8.15", features = ["xxh3", "const_xxh3"] }
tracing = "0.1"
+99 -64
View File
@@ -1,12 +1,14 @@
//use ahash::RandomState;
use crossbeam_channel;
use hashbrown::HashMap;
use obikseq::k;
use obikseq::{CanonicalKmer, Sequence};
use obikseq::{CanonicalKmer, Sequence, Unitig};
#[cfg(not(any(test, feature = "test-utils")))]
use rayon::iter::{IntoParallelRefIterator, ParallelIterator};
use std::cell::RefCell;
use std::fmt;
use std::sync::atomic::{AtomicU8, Ordering};
use xxhash_rust::xxh3::Xxh3Builder;
use tracing::{debug, info};
// ── Types ─────────────────────────────────────────────────────────────────────
@@ -96,26 +98,6 @@ impl Node {
(self.0 >> 5) & 0b11
}
/// Number of left neighbours.
pub fn n_left_neighbours(self) -> u8 {
if self.can_extend_left() {
1
} else {
let v = (self.0 >> 5) & 0b11;
v + (v != 0) as u8
}
}
/// Number of right neighbours.
pub fn n_right_neighbours(self) -> u8 {
if self.can_extend_right() {
1
} else {
let v = (self.0 >> 3) & 0b11;
v + (v != 0) as u8
}
}
/// Marks the node as visited.
#[inline]
pub fn set_visited(&mut self) {
@@ -162,13 +144,17 @@ impl fmt::Display for Node {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("→{}", NUC[self.right_nuc() as usize])
} else if (self.0 >> 3) & 0b11 == 0 {
"→0".to_string()
} else {
format!("→{}", self.n_right_neighbours())
"→≥2".to_string()
};
let l = if self.can_extend_left() {
format!("←{}", NUC[self.left_nuc() as usize])
} else if (self.0 >> 5) & 0b11 == 0 {
"←0".to_string()
} else {
format!("←{}", self.n_left_neighbours())
"←≥2".to_string()
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
@@ -192,8 +178,12 @@ impl WalkState {
}
pub fn reachable(&self, graph: &GraphDeBruijn) -> bool {
WalkState { kmer: self.kmer, node: self.node, direct: !self.direct }
.leavable(graph)
WalkState {
kmer: self.kmer,
node: self.node,
direct: !self.direct,
}
.leavable(graph)
}
pub fn walk(&self, graph: &GraphDeBruijn) -> Option<(WalkState, u8)> {
@@ -209,8 +199,19 @@ impl WalkState {
if next_node.is_visited() {
return None;
}
let reachable = if dnext { next_node.can_extend_left() } else { next_node.can_extend_right() };
reachable.then_some((WalkState { kmer: cnext, node: next_node, direct: dnext }, nuc))
let reachable = if dnext {
next_node.can_extend_left()
} else {
next_node.can_extend_right()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
nuc,
))
} else {
if !self.node.can_extend_left() {
return None;
@@ -223,8 +224,19 @@ impl WalkState {
if next_node.is_visited() {
return None;
}
let reachable = if dnext { next_node.can_extend_right() } else { next_node.can_extend_left() };
reachable.then_some((WalkState { kmer: cnext, node: next_node, direct: dnext }, 3 - nuc))
let reachable = if dnext {
next_node.can_extend_right()
} else {
next_node.can_extend_left()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
3 - nuc,
))
}
}
}
@@ -281,14 +293,13 @@ impl GraphDeBruijn {
}
let (rc, rn) = count_neighbors(&kmer.right_canonical_neighbors(), &self.nodes);
let (lc, ln) = count_neighbors(&kmer.left_canonical_neighbors(), &self.nodes);
let mut node = Node(0); // reset all bits (visited=0, start=0)
let mut node = Node(0);
node.set_right(rc, rn);
node.set_left(lc, ln);
atomic.store(node.0, Ordering::Relaxed);
});
// Pass 2: mark start nodes
self.for_each_node(|kmer, atomic| {
let mut node = Node(atomic.load(Ordering::Relaxed));
if node.is_visited() {
@@ -336,14 +347,28 @@ impl GraphDeBruijn {
}
fn unitig_nucleotides(&self, kmer: CanonicalKmer, k: usize) -> Option<UnitigNucIter<'_>> {
let old = self.nodes.get(&kmer)?.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
if old & IS_VISITED_MASK != 0 { return None; }
let old = self
.nodes
.get(&kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
if old & IS_VISITED_MASK != 0 {
return None;
}
let start = WalkState::new(kmer, Node(old), true);
let next_step = start.walk(self).and_then(|(next_state, nuc)| {
let ext_old = self.nodes.get(&next_state.kmer)?.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
let ext_old = self
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(ext_old & IS_VISITED_MASK == 0).then_some((next_state, nuc))
});
Some(UnitigNucIter { graph: self, start: kmer, pos: 0, k, next_step })
Some(UnitigNucIter {
graph: self,
start: kmer,
pos: 0,
k,
next_step,
})
}
pub fn for_each_unitig(&self, f: impl Fn(UnitigNucIter<'_>) + Sync) {
@@ -352,7 +377,6 @@ impl GraphDeBruijn {
let n2 = std::sync::atomic::AtomicUsize::new(0);
// Boucle unique : traiter les starts, recalculer les arités, recommencer
let mut pass = 0usize;
loop {
let n_new = std::sync::atomic::AtomicUsize::new(0);
@@ -360,7 +384,9 @@ impl GraphDeBruijn {
self.nodes
.par_iter()
.filter_map(|(&kmer, atomic)| {
Node(atomic.load(Ordering::Acquire)).is_start().then_some(kmer)
Node(atomic.load(Ordering::Acquire))
.is_start()
.then_some(kmer)
})
.for_each(|kmer| {
if let Some(iter) = self.unitig_nucleotides(kmer, k) {
@@ -380,9 +406,7 @@ impl GraphDeBruijn {
});
let n = n_new.load(Ordering::Relaxed);
debug!("[for_each_unitig] pass {}: {} starts", pass, n);
n_chains.fetch_add(n, Ordering::Relaxed);
pass += 1;
if n == 0 {
break;
}
@@ -411,12 +435,6 @@ impl GraphDeBruijn {
}
}
info!(
chains = n_chains.load(Ordering::Relaxed),
phase2 = n2.load(Ordering::Relaxed),
total = n_chains.load(Ordering::Relaxed) + n2.load(Ordering::Relaxed),
"unitig traversal complete"
);
}
/// Merge `other` into `self`.
@@ -460,19 +478,31 @@ impl GraphDeBruijn {
pub fn try_for_each_unitig<E, F>(&self, f: F) -> Result<(), E>
where
E: Send,
F: FnMut(UnitigNucIter<'_>) -> Result<(), E> + Send,
F: FnMut(&Unitig) -> Result<(), E> + Send,
{
let error = std::sync::Mutex::new(None::<E>);
let f = std::sync::Mutex::new(f);
self.for_each_unitig(|iter| {
if error.lock().unwrap().is_some() {
return;
}
if let Err(e) = f.lock().unwrap()(iter) {
*error.lock().unwrap() = Some(e);
}
});
error.into_inner().unwrap().map_or(Ok(()), Err)
thread_local! {
static BUF: RefCell<Vec<u8>> = RefCell::new(Vec::with_capacity(4096));
}
let (tx, rx) = crossbeam_channel::bounded::<Unitig>(rayon::current_num_threads() * 256);
std::thread::scope(|s| {
let writer = s.spawn(move || -> Result<(), E> {
let mut f = f;
for unitig in rx {
f(&unitig)?;
}
Ok(())
});
self.for_each_unitig(|iter| {
BUF.with(|buf| {
let mut buf = buf.borrow_mut();
buf.clear();
buf.extend(iter);
tx.send(Unitig::from_nucleotides(&buf)).ok();
});
});
drop(tx);
writer.join().expect("writer thread panicked")
})
}
pub fn len(&self) -> usize {
@@ -504,7 +534,11 @@ impl Iterator for UnitigNucIter<'_> {
Some(nuc)
} else if let Some((state, nuc)) = self.next_step.take() {
self.next_step = state.walk(self.graph).and_then(|(next_state, next_nuc)| {
let old = self.graph.nodes.get(&next_state.kmer)?.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
let old = self
.graph
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(old & IS_VISITED_MASK == 0).then_some((next_state, next_nuc))
});
Some(nuc)
@@ -527,22 +561,23 @@ fn count_neighbors(
nodes: &FastHashMap<CanonicalKmer, AtomicU8>,
) -> (u8, Option<u8>) {
let mut count = 0u8;
let mut first = None;
let mut nuc = 0u8;
for (i, neighbour) in neighbors.iter().enumerate() {
if let Some(a) = nodes.get(neighbour) {
if Node(a.load(Ordering::Relaxed)).is_visited() {
continue;
}
nuc = i as u8;
count += 1;
if first.is_none() {
first = Some(i as u8);
if count >= 2 {
return (2, None);
}
}
}
if count == 1 {
(1, first)
(1, Some(nuc))
} else {
(count, None)
(0, None)
}
}
+26 -3
View File
@@ -1,6 +1,17 @@
use super::*;
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
// file don't all use the same `k` (`push_palindrome_single_node` needs an
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
// use k=5), and they run concurrently by default. Serialize the
// set_k-through-use critical section across this file's tests so one test's
// `k` can never be overwritten mid-flight by another.
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
}
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
@@ -24,8 +35,8 @@ fn canonical_kmers(seq: &[u8]) -> Vec<CanonicalKmer> {
fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
let mut unitigs = Vec::new();
g.try_for_each_unitig(|nuc_iter| -> Result<(), std::convert::Infallible> {
unitigs.push(nuc_iter.collect());
g.try_for_each_unitig(|unitig| -> Result<(), std::convert::Infallible> {
unitigs.push(unitig.clone());
Ok(())
})
.unwrap();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let _guard = lock_k();
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32;
const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t
}
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap();
fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
}
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+14 -1
View File
@@ -10,9 +10,22 @@ obiskio = { path = "../obiskio" }
obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" }
obiskbuilder = { path = "../obiskbuilder" }
obipipeline = { path = "../obipipeline" }
ndarray = "0.16"
rayon = "1"
rayon = "1"
crossbeam-channel = "0.5"
serde = { version = "1", features = ["derive"] }
serde_json = "1"
indicatif = "0.17"
tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
[features]
default = ["numa"]
numa = ["hwlocality"]
+4
View File
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
Jaccard,
/// Hamming distance (number of differing kmer positions) on presence/absence data.
Hamming,
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
Mash,
/// Bray-Curtis dissimilarity on raw counts.
BrayCurtis,
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
@@ -84,6 +86,7 @@ impl KmerIndex {
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(),
@@ -108,6 +111,7 @@ impl KmerIndex {
let matrix = match metric {
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
DistanceMetric::Hamming => {
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
}
+78 -24
View File
@@ -1,4 +1,7 @@
use std::io::Write;
use std::sync::atomic::{AtomicUsize, Ordering};
use rayon::prelude::*;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
@@ -13,14 +16,19 @@ impl KmerIndex {
/// `force_presence` overrides `with_counts`: even if the index stores counts,
/// the output uses 0/1 presence columns.
///
/// Partitions are scanned in parallel; each partition buffers its output locally
/// before the main thread writes the chunks in partition order.
///
/// The caller must have set the global kmer length (`obikseq::set_k`) before
/// calling this method.
pub fn dump<W: Write>(
pub fn dump<W: Write, F: Fn() + Send + Sync>(
&self,
out: &mut W,
force_presence: bool,
debug: bool,
head: Option<usize>,
filters: &[Box<dyn KmerFilter>],
on_partition: F,
) -> OKIResult<()> {
let genomes = &self.meta.genomes;
let use_counts = self.meta.config.with_counts && !force_presence;
@@ -37,30 +45,76 @@ impl KmerIndex {
}
writeln!(out)?;
// ── Rows ──────────────────────────────────────────────────────────────
// ── Rows — parallel over partitions ───────────────────────────────────
let n = self.n_partitions();
for i in 0..n {
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii())
.unwrap_or_else(|_| "?".repeat(kmer_size));
let _ = write!(out, "{part},{layer},{seq}");
for &v in row.iter() { let _ = write!(out, ",{v}"); }
let _ = writeln!(out);
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii())
.unwrap_or_else(|_| "?".repeat(kmer_size));
let _ = write!(out, "{seq}");
for &v in row.iter() { let _ = write!(out, ",{v}"); }
let _ = writeln!(out);
})
.map_err(OKIError::Partition)?;
}
let write_row = |buf: &mut Vec<u8>, row: &[u32], prefix: &str| {
let _ = buf.write_all(prefix.as_bytes());
for &v in row { let _ = write!(buf, ",{v}"); }
let _ = buf.write_all(b"\n");
};
let chunks: Vec<OKIResult<Vec<u8>>> = if let Some(limit) = head {
// ── Bounded: atomic counter, early exit when limit reached ────────
let remaining = AtomicUsize::new(limit);
(0..n).into_par_iter().map(|i| {
if remaining.load(Ordering::Relaxed) == 0 { return Ok(vec![]); }
let mut buf = Vec::<u8>::new();
let try_write = |buf: &mut Vec<u8>, row: &[u32], prefix: &str| -> bool {
match remaining.fetch_update(Ordering::SeqCst, Ordering::SeqCst, |cur| {
if cur > 0 { Some(cur - 1) } else { None }
}) {
Err(_) => false,
Ok(_) => { write_row(buf, row, prefix); true }
}
};
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
try_write(&mut buf, &row, &format!("{part},{layer},{seq}"))
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
try_write(&mut buf, &row, &seq)
})
.map_err(OKIError::Partition)?;
}
on_partition();
Ok(buf)
}).collect()
} else {
// ── Unbounded: no atomic, no contention ───────────────────────────
(0..n).into_par_iter().map(|i| {
let mut buf = Vec::<u8>::new();
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
write_row(&mut buf, &row, &format!("{part},{layer},{seq}"));
true
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
write_row(&mut buf, &row, &seq);
true
})
.map_err(OKIError::Partition)?;
}
on_partition();
Ok(buf)
}).collect()
};
// ── Sequential write ──────────────────────────────────────────────────
for chunk in chunks {
out.write_all(&chunk?)?;
}
out.flush()?;
+29 -45
View File
@@ -1,8 +1,6 @@
use std::collections::BTreeMap;
use std::fs;
use std::path::{Path, PathBuf};
use std::sync::atomic::{AtomicUsize, Ordering};
use std::sync::{Arc, Mutex};
use obikpartitionner::{KmerPartition, KmerSpectrum};
use obilayeredmap;
@@ -152,31 +150,25 @@ impl KmerIndex {
let with_counts = self.meta.config.with_counts;
let evidence = self.meta.config.evidence.clone();
let block_bits = self.meta.config.block_bits;
let total_kmers = AtomicUsize::new(0);
let mut total_kmers: usize = 0;
let pb = progress_bar("index", n as u64, "partitions");
let pb = Arc::new(Mutex::new(progress_bar("index", n as u64, "partitions")));
(0..n).into_par_iter().for_each(|i| {
match self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits) {
Ok(0) => {}
Ok(n_kmers) => {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
let pb = pb.lock().unwrap();
let order: Vec<usize> = (0..n).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits),
|i, n_kmers, _| {
if n_kmers > 0 {
total_kmers += n_kmers;
pb.inc(1);
pb.set_message(format!("{i}: {n_kmers} kmers"));
}
Err(e) => {
eprintln!("error building layer for partition {i}: {e}");
std::process::exit(1);
}
}
});
},
).map_err(OKIError::Partition)?;
pb.lock().unwrap().finish_and_clear();
info!(
"done — {} total kmers indexed",
total_kmers.load(Ordering::Relaxed)
);
pb.finish_and_clear();
info!("done — {} total kmers indexed", total_kmers);
if !keep_intermediate {
for i in 0..n {
@@ -211,35 +203,27 @@ impl KmerIndex {
use obilayeredmap::meta::PartitionMeta;
let n = self.n_partitions();
let errors: Vec<_> = (0..n)
.into_par_iter()
.filter_map(|i| {
let order: Vec<usize> = (0..n).collect();
let pb = progress_bar("pack", n as u64, "partitions");
crate::numa::PartitionRunner::new().run(
&order,
|i| -> OKIResult<()> {
let index_dir = self.partition.part_dir(i).join("index");
if !index_dir.exists() { return None; }
let meta = match PartitionMeta::load(&index_dir) {
Ok(m) => m,
Err(e) => return Some(OKIError::Io(std::io::Error::new(std::io::ErrorKind::Other, e.to_string()))),
};
if !index_dir.exists() { return Ok(()); }
let meta = PartitionMeta::load(&index_dir)
.map_err(|e| OKIError::Io(std::io::Error::new(std::io::ErrorKind::Other, e.to_string())))?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let presence_dir = layer_dir.join("presence");
let counts_dir = layer_dir.join("counts");
if presence_dir.exists() {
if let Err(e) = pack_bit_matrix(&presence_dir) {
return Some(OKIError::Io(e));
}
}
if counts_dir.exists() {
if let Err(e) = pack_compact_int_matrix(&counts_dir) {
return Some(OKIError::Io(e));
}
}
if presence_dir.exists() { pack_bit_matrix(&presence_dir).map_err(OKIError::Io)?; }
if counts_dir.exists() { pack_compact_int_matrix(&counts_dir).map_err(OKIError::Io)?; }
}
None
})
.collect();
if let Some(e) = errors.into_iter().next() { return Err(e); }
Ok(())
},
|_, _, _| { pb.inc(1); },
)?;
pb.finish_and_clear();
Ok(())
}
+4
View File
@@ -5,8 +5,11 @@ mod distance;
mod dump;
mod index;
mod merge;
mod numa;
mod rebuild;
mod reindex;
mod select;
mod siblings;
mod stats;
pub use error::{OKIError, OKIResult};
@@ -16,3 +19,4 @@ pub use merge::MergeMode;
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
pub use stats::IndexBitsPerKmer;
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};

Some files were not shown because too many files have changed in this diff Show More